I have 2 fastq files for the same sample, Sample1, but each with different read length(75bp and 100bp)
zcat Sample1_TTAGGC_L001_R1_001.fastq.gz | head -8 # few lines from first file
@HWI-D00330:52:H7TTTADXX:1:1101:1097:2122 1:N:0:TTAGGC
TACAACTGGTGAGTTTTTCCTCCAGCCTCCCTGTGACCCCTCACAACCCACCCCAGACAATGCTTTTCCTTCCCT
+
@@@DFFFFGDFHDFHIJJJEGIGHIGGIGGIIGHIIHGGIIJEHGEIGJIIGIIHIGIGEHECEFCB>>CD;@CC
@HWI-D00330:52:H7TTTADXX:1:1101:1161:2171 1:N:0:TTAGGC
GAGTCCATCTAGCCCAACCCAGACCAAGGGATTCACCTGAATATTCTCTTCTCACCTTTCATCATAGCTAAGATT
+
CCCFFFFFHHHHHJJFHHIJJHIJJJJJIIJJJJJJJJJHIGJJJIIJJJJJJJJJJJJJJJJJJJJJJIJEHHH
zcat Sample1_TTAGGC_L1234_R1_001.fastq.gz | head -8 # few lines from second file
@HWI-ST332R:292:D2GD6ACXX:1:1101:1123:2179 1:N:0:TTAGGC
TTTACTTGGCCTATTAGTGCCCTTCAGAAACTAATGACTCTTTCTTTGACCAAATTTACTCTCTTCATGTCCCTGTCCTTTGCCCCATATCCCCATTCCC
+
BCCDFFFDGHHHHHJIJFIIIEHJJGJJJJJJIJJIGIIJIJJGIJJCDDGIJJIJJGFHIIJJJIJJIIJJJJIJGIJJJHHHHGFFBEFEEDECCE>@
@HWI-ST332R:292:D2GD6ACXX:1:1101:2304:2176 1:N:0:TTAGGC
GANACTCTGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAATTAAGGAAGAGTAAAGGGAAAATAATTTTTTTAAAAGTGTCTTTAAATTTGGAAAGGTTG
+
CC#4ADDFHFFHFIGIIIGIIJJJJJJHDDDDDDDB################################################################**
Took few reads from these 2 files and with the resultant file gave a bwa run and it did run w/o any error. Wanted to know whether it is OK to do so, would it impact the output(.sai file) after alignment ?
zcat Sample1_TTAGGC_L001_R1_001.fastq.gz | head -8 > f1.fastq
zcat Sample1_TTAGGC_L1234_R1_001.fastq.gz | head -8 > f2.fastq
cat f1.fastq f2.fastq > Out.fastq
gzip Out.fastq
bwa aln -t 4 hs37d5.fa Out.fastq.gz >Out.sai
Thanks, Tinu
•
written
by
ttom
1 answer
This is a perfectly fine thing to do and actually ends up not being that unusual.
Consider a standard experimental workflow. First, you receive raw reads all of the same length, but each showing varying amount (from complete to none) of adapter contamination and 3' quality decrease. The normal next step is to trim these adapter sequences off the ends of reads and, since you're already processing through the file, trim low quality regions from the ends as well (N.B., there's often no need to be very aggressive with quality trimming). The result of this is that many of your reads are now shorter than they were before. If you had paired-end reads to begin with, you'll often find that read #2 is shorter than read #1. This isn't a problem for bwa or any of the other standard aligners that I can think of.
As an aside, instead of doing this:
zcat Sample1_TTAGGC_L001_R1_001.fastq.gz | head -8 > f1.fastq
zcat Sample1_TTAGGC_L1234_R1_001.fastq.gz | head -8 > f2.fastq
cat f1.fastq f2.fastq > Out.fastq
gzip Out.fastq
You could simply do this:
cat Sample1_TTAGGC_L001_R1_001.fastq.gz Sample1_TTAGGC_L1234_R1_001.fastq.gz > Out.fastq.gz
The gzip format allows multiple records to be directly concatenated like that. This will work for most things (though not always with java, for reason that I've never looked into since it's easy to handle this with most APIs) and save you considerable time.
Log in to answer this question.
-
Decipher 3' 10X paired-end reads
written by tvibhaps •
-
Warnings in the Hisat2 alignment output files
written by newbie
-
SRA to FASTQ problem
written by m.t.lorenc •
-
Bwa Mem Strange Id
written by Nicolas Rosewick
-
Split Fastq Files With A Pattern
written by Assa Yeroslaviz
-
Help Needed For Formatting Fasta Headers
written by redspider19800915 •
-
Working With Fastq Files In Gmap
written by Assa Yeroslaviz
-
Parsing Fastq Files
written by deepthitheresa •
-
Unmapped Reads And Sequence Name
written by Stefano Berri
-
How To Fix Fastq File From Sra When Fastq-Dump Split At Wrong Position
written by Aaron H
That's fine. Having reads of different lengths would be totally normal after trimming.
Thank you for the answer
It would be good for posterity if you could add this comment as an answer, then the OP could "accept" it.
Yeah, I should have done that after ashutoshmits comments, but was hoping someone else might produce a highly descriptive answer :oP I'll throw something a little longer-winded together real quick as an answer.
I am closing this question as it has been answered.
?? Well... an answered question is not a reason to close it...
re-opened. Questions should only be closed when they're unanswerable, duplicates of previous questions, or break the guidelines in some other way.
Thanks. Got it. There should be a way that trivial questions that have already been answered should not appear on top. People may spend time reading the question only to find out in the end that it was a simple one and has been solved. I am not blaming the simplicity of the question but just don't want people to spend time on reading something that is easy and has already been solved.
Sure - If it's been asked and answered previously, then post a comment linking back to the old post that answers it, and close it up as a duplicate.