Hi,
I am trying to work with the gmap/gsnap tools. I have fastq files and wanted to ask whether it make sense at all to try and convert the reads into fastA format so that I can work with the gmap tool.
I think, gmap work only with fastA but not with fastq, while gsnap can work with both.
I converted the fastq to fastA which looks like that:
>HWI-ST863:138:D0WT7ACXX:5:1101:1179:1941 1:N:0:GCCAAT
ACTTACAGCATCCTCTCATCTGGGTTAACTTACTCTTGGAGGAGATGAAGGTCACTGTGCCTGGCTATCAAACCTTCCATGCTGCTCCACAGAGACAAAGA
>HWI-ST863:138:D0WT7ACXX:5:1101:1577:1894 1:N:0:GCCAAT
NTGTGAGTATGTGTGTTGTGAGAGAGAGTATGTTTGTGTGTGTGAATGTGTGTGTCTCTGTGAGTGTGTGTGTGTGAGAGTATGTTTGTGTGTGTGTGAAT
>HWI-ST863:138:D0WT7ACXX:5:1101:1718:1912 1:N:0:GCCAAT
CTGCCTCTTCACATCTCAAAAGGTGATTAACATCCGGAGATTTACATCATCTGCCAAGTCCTGCTGATCAAACAGCAGGGTAAGTATGGAGAAGGGCCACA
...
I created the indexed files with my fastA DNA file. It worked good, but when I am running the gmap, it gives me always the error message "no paths found"
and the files resulted is .nomapping .fa, which looks like that:
>HWI-ST863:138:D0WT7ACXX:5:1101:1403:1981 1:N:0:AGTCAA
Paths (0):
>HWI-ST863:138:D0WT7ACXX:5:1101:1470:1997 1:N:0:AGTCAA
Paths (0):
>HWI-ST863:138:D0WT7ACXX:5:1101:1677:1894 1:N:0:AGTCAA
Paths (0):
...
Is there an explanation for this behavior? Is it possible to use this fastq-converted fastA files to run gmap?
Thanks for the help, Assa
0 answers
No answers yet.
Log in to answer this question.
-
Fastq file from SRA database not mapping to to the genome
written by amoltej
-
Separate the reverse sequence from R1 and corresponding forward seq from R2
written by Sajan Raju •
-
How to split Illumina Hiseq 2000 paired-end fastq files?
written by Yuka Takemon •
-
Bwa Run With Fastq File With Different Read Length
written by ttom
-
Split Fastq Files With A Pattern
written by Assa Yeroslaviz
-
Visualizing Bowtie Output In Genome Browser
written by k.nirmalraman
-
Help Needed For Formatting Fasta Headers
written by redspider19800915 •
-
How To Extract Reads With Wrong Insert Size With Samtools
written by Assa Yeroslaviz
-
Fastq File Without Index?
written by lsvijfhuizen •
-
Parsing Fastq Files
written by deepthitheresa •
Just out of curiosity, why do you want to avoid using gsnap?
Could you supply the gmap command line?
I am searching for large indels in the genome of my mutated mice. I wanted to try and map them to the genome to see if I can detect any large insertions/deletion with gmap or gsnap.
I don't want to avoid gsnap, I just wanted t see the differences between the mapping of the two software. I think, if it is possible to map the fatsq file to the genome, it will be easier to observe the deletions.
my gmap command is:
any ideas?
what about using another mapping tool, such as blat.