This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Parsing Fastq Files

Hi all,

I have Fastq reads something like 

@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918 1:N:0:CGATGT
NACCCTAGAAATTATAAATCTCTTCAAGTGAGATTGTAAGGAGAAGGAGAAACTTGGTCTGGAATTTGTTATAAAAGCACTT
+
#1=DDFFFHHGGHIJJJJJIJJJJJJJJCHGHIIJJEFHIJIJJIIJIIIIJHHIJJFHIIJJJJJJJIJIJIJIIJHEHHHHFFFFFFEEEDEEEDCDDC

I aligned this fastq file with a reference genome using bowtie. How can I identify the sample name from this record?

I have demultiplexed fastq files for each sample and I also have barcode information file in the format

sample name    Index sequence
BC1                  CGATGT
BC2                  CGATGA

When I try to retrieve the alignment information using $sam->features() the seqID will be returned as 

@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918

How can I get the 1:N:0:CGATGT part from the alignment information?

Thanks, Deeps

fastq parsing
• 5,215 views • link
updated by jingtao09 • jingtao09 • written by deepthitheresa • deepthitheresa

2 answers

I'd suggest that you use SAM Read Groups to track samples. This would be done at the alignment stage....

• 0 views • link
written by Sean Davis Sean Davis

If you want to keep the barcode in SAM file, you can add a non-space character in between the main header and the barcode section.

@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918 1:N:0:CGATGT

to be

@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918:1:N:0:CGATGT

here I used a colon ":", so if you parse this header, you can use split function to get the barcode.in Python

header="@HWI-ST1162:73:C0KEFACXX:6:1101:1816:1918:1:N:0:CGATGT"
barcode=header.rstrip("\n").split(":")[-1]

Normally, most of the mapper, i.e BWA or BOWTIE will truncate the header name after a space. so if you preprocess your FASTQ file into this new format you will save alot time. Otherwise, if you are not able to do the modification on the FASTQ reads, you can open the original FASTQ file and SAM file at same time to calibrate the line numbers and parse out the barcode.

• 2 views • link
updated by Istvan Albert Istvan Albert • written by jingtao09 • jingtao09

Log in to answer this question.

More posts like this