Thanks for reply. Yes, both files are from different organisms. I just used them to compare if there is any issue with the fastq file format. Here is the fasta file part that i am using. this is basically few genes I selected for my study -
>NM_001112236_1_Zea_mays_colored_plant_1_b1
ATGGCGCTCTCAGCTTCCCCGGCTCAGGAAGAACTGCTGCAGCCTGCTGGGAGGCCGTTGAGGAAGCAGCTT
GCTGCAGCCGCGAGGAGCATCAACTGGAGCTATGCCCTCTTCTGGTCCATTTCAAGCACTCAACGACCTC
GGGTGCTGACGTGGACGGACGGGTTCTACAATGGCGAGGTGAAGACGCGTAAGATCTCCCACTCCGTGGA
GCTGACAGCCGACCAGCTGCTCATGCAGAGGAGCGAGCAGCTCCGGGAGCTCTACGAGGCCCTCCGGTCC
GGCGAGTGCGACCGCCGCGGCGCGCGGCCGGTGGGCTCGCTGTCGCCGGAGGACCTCGGGGACACCGAGT
>DQ275529_1_Antirrhinum_majus_ROSEA1
ATGGAAAAGAATTGTCGTGGAGTGAGAAAAGGTACTTGGACCAAAGAAGAAGACACTCTCTTGAGGCAAT
GTATAGAAGAGTATGGTGAAGGGAAATGGCATCAAGTTCCACACAGAGCAGGGTTGAACCGGTGTAGGAA
GAGTTGCAGGCTGAGGTGGTTGAATTATCTGAGGCCAAATATCAAAAGAGGTCGGTTTTCGAGAGATGAA
GTGGACCTAATTGTGAGGCTTCATAAGCTGTTGGGTAACAAATGGTCGCTGATTGCTGGTAGAATTCCTG
GAAGGACAGCTAATGACGTGAAGAACTTTTGGAATACTCATGTGGG
What was the error? Can please post it.
When I ran STAR this is the last part of the log.out file -
That log appears to be just for generation of genome indexes. Have you done the actual alignment? Please post the full STAR command lines you have used for genome index generation and for alignment runs.
first I ran this
STAR --runMode genomeGenerate --genomeDir . --genomeFastaFiles MYB_and_MYC.fasta --runThreadN 5Then
STAR --runThreadN 14 --sjdbOverhang 50 --readFilesCommand zcat --sjdbGTFfile myb_myc.gtf --readFilesIn SRR867425_1.fastq.gz SRR867425_2.fastq.gz --runMode alignReads --outReadsUnmapped Fastx --limitBAMsortRAM 8729257684 --genomeDir . --outSAMtype BAM SortedByCoordinate --outSAMstrandField intronMotif --outFilterIntronMotifs RemoveNoncanonical --twopassMode Basic --outSAMattrRGline ID:"MYB_MYC" --outFileNamePrefix "MYB_MYC"_ --quantMode GeneCountsI suggest that you create a separate directory to hold the STAR indexes and supply it to
--genomeDiroption (instead of just./).its still not working. exiting with the error message
Segmentation fault (core dumped)at the 1st pass mappingAt least we have made some progress. How much memory are you assigning to this job (or should ask how much memory you have available)?
I am not assigning any particular number but I am running with 15 threads with 64GB ram. No other program is running on machine
Try reducing the number to 4 and see if that prevents the seg fault.