This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Decipher 3' 10X paired-end reads

How to read barcode and umi in 3'v.3.1 10X read1, when GTGGATCAAA+CAGGGTTGGC is same in read 1 and read 2 both? Thanks

Read1 

zcat R1.fastq.gz | head -n 10
@A00564:489:HK52WDSX3:3:1101:1362:1000 **1:N:0:GTGGATCAAA+CAGGGTTGGC**
NGCTTGCGTCTAATCGGCAAACCTTAAGAAAAAAAATCAAAAAAAAAAATGGTGTTATGGGTTTATGAGGTCTGCATTACTGGCGCATGTAGGCAAAGACACTCAGCACAACTTGACAAGACAGCGCTCATTTCCAAATCTCTCTCTGAC
+
#:FFFFFFFFFFFFFFFFFFFFFFFFFF,F,FF,FF,,::,,,,F:F,F,,,:,F,,FF::F:F,::F:FF,,F:F:F:,:F,:,:FFF:,,:,F,F:,::,::,,,FF,,:,,,,::F,,::F,::,:FFF,:F:,,,:,:,,,,,,F,
@A00564:489:HK52WDSX3:3:1101:2193:1000 1:N:0:GTGGATCAAA+CAGGGTTGGC
NTGCCTCAGTTTCTTCACTTCGGCTCCAACCAAACAACAATATAAAATTTGTGTGCCACTACCACCAAAATCTTCACCCGCGGCGGCTCCCCCCGGGCCCGCGCCCTCTGCTTCCGAGCTCCCCGCGGCGGCCCACCTACACTGCGCGGC

Read2

zcat R1.fastq.gz | head -n 10
@A00564:489:HK52WDSX3:3:1101:1362:1000 **2:N:0:GTGGATCAAA+CAGGGTTGGC**
CGCGTCTGACTACGGATCAGAAGATTCTAGGTTCGACTCCTGGCAAGCTCGTGCATTTTTTCTATGTCTGAGTGAGATTTGGAAATGAGCGATGTCTTTTCAATTTGTGCTGAGTGTCTTTGCCTACATGCGCCATTAATGCATACCTCA
umi barcode
• 1,525 views • link
written by tvibhaps • tvibhaps

Can you elaborate what the problem is? R1 contains UMI+CB and R2 contains the cDNA. Specialized software such as CellRanger, STARsolo, kallisto-bustools or alevin will deal with that.

• 0 views • link
written by ATpoint ATpoint

Yes sure! These above are 3' v3.1 10X (Paired-end150bp per sample) R1 and R2 reads.

  • I want to know how to recognize barcode and umi in read 1 i.e. R1 by looking into it?
  • Do these reads have total 300bp. i.e. 2 X150?
  • I do not see any option for mapping 3' 10X Paired-end mapping on starsolo, only 3' 10X mapping instead. How to do starsolo mapping for 3' Paired-end 10X reads? I am still referring starsolo github page. Thanks
• 0 views • link
written by tvibhaps • tvibhaps

I want to know how to recognize barcode and umi in read 1 i.e. R1 by looking into it?

Check with the 10x documentation. R1 has the CB at 1-16 and UMI at 17-28. That is always the same for v3.

Do these reads have total 300bp. i.e. 2 X150?

I do not understand. It is paired-end sequencing, I suggest you familiarize yourself with the principle. It is two independent reads but actually for R1 you only need the first 28bp, the rest is meaningless / rubbish.

I do not see any option for mapping 3' 10X Paired-end mapping on STARsolo (...)

It's the same. 10x is always paired-end. Read the manual, it will instruct how to read in R1 and R2 with STARsolo.

• 0 views • link
written by ATpoint ATpoint

0 answers

No answers yet.

Log in to answer this question.

More posts like this