How to run TRUST4 for BCR/TCR detection using 10X data?
I'm trying to follow this tutorial here: https://github.com/liulab-dfci/TRUST4#10x-genomics-data-and-barcode-based-single-cell-data
However, I'm not sure how to adapt my data.
I have R1 reads that look like this where the reads are 28 bp long:
@A00588:95:H2H5KDRX3:1:1101:1163:1000 1:N:0:GTAACATGCG+AGGTAACACT
AGCTATCTACTTCTGGTACAACCCACTN
+
FFFF,FFFFF:FFFFFFF:FF:FFFFF#
@A00588:95:H2H5KDRX3:1:1101:1904:1000 1:N:0:GTAACATGCG+AGGTAACACT
My R2 reads look like this and they 90 bp long:
@A00588:95:H2H5KDRX3:1:1101:1163:1000 2:N:0:GTAACATGCG+AGGTAACACT
ATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCATGGAATCTTGTAGAGATACGGGAGTGCCTTCGGGACC
+
:,FFFFFF:::F:,F::F:FF:FFFF:FF:FF:F:F:::FFFFFFFF,FFF,,FF,,FFF:FF:FFF:F,FFFF,FFFFFFFFFFF,,F
My usual TRUST4 command for paired end data is the following:
run-trust4 -1 ${R1} -2 ${R2} -o ${OUT_DIR}/trust4 -f References/hg38_bcrtcr.fa --ref References/human_IMGT+C.fa
How can I update to use 10X data?
Following the tutorial, how can I know what the barcode is above to follow this usage? -1 read1.fq.gz -2 read2.fq.gz --barcode read1.fq.gz --read-format bc:0:15,r1:16:-1
• 2,101 views
•
link
0 answers
No answers yet.
Log in to answer this question.
if you have the bam file from cellranger, using the bam input will be much faster.
Unfortunately I only have the forward and reverse reads.