This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bwa Mem Strange Id

Hi,

After using bwa mem to align paired-end data I've strange results in my data :

I've a sam entry with a strange read id :

<<F6@C8,,,;6,C<F<F<FGFFEDCE@CE@,<,,,@,6BF@F9B,,;,5,C?F    133    chr11    505    0    *    =    505    0        *    AS:i:0    XS:i:0

but this id is not in my R1.fastq and R2.fastq file ...

the command : bwa mem -t 5 -M -L 1 genome R1.fastq.gz R2.fastq.gz > out.sam with bwa 0.7.5a-r405

and here a subset of R1.fastq.gz reads

@M00991:61:000000000-A7EML:1:1101:15262:1043 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACACAACCCACTCCAGTATACTGTCTCTTATCACATCTCCGAGCCCACG
+
BCC<ABF<CEGGEC::CFGGCFGDGGGGG@FGFECGGGEFGF@EF@FGDG,C@FEEEC@@FF<FEEF@FEGEGCG7
@M00991:61:000000000-A7EML:1:1101:19117:1047 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACAAGAAATATCAATAGCACTGTCTCTTATACAATCTCCGAGCCCACGA
+
CCCCCGGGGGGGGGGGGGGGGGGGFFFFGFFEFCEFGDC@<E,6CCD8EFGGGFGFFGGGF9FEF,CCFGGGAFF:
@M00991:61:000000000-A7EML:1:1101:10229:1061 1:N:0:16
GGCTCCTAGGTCGGCATGATCTTTCATACAAATGACTCCCCCTCAAAAAAGGCGGGAGAGCCATTCATTTTCTAA

Anyone knows the solution ?

EDIT > Seems to be a problem with the fastq files.

Thanks

• 2,623 views • link
written by Nicolas Rosewick Nicolas Rosewick

what's the output of file R1.fastq.gz R2.fastq.gz and gunzip -c R1.fastq.gz|head ?

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Please share the answer if you solved the problem, it may be helpful to someone in the future. It's not clear what the issue is with the fastq files (newlines maybe?).

• 11 views • link
written by SES SES

1 answer

I resolve the problem myself. It was a problem in the fastq files that I preprocessed before mapping. I "grep" a quality line unstead of an id...

• 0 views • link
written by Nicolas Rosewick Nicolas Rosewick

Log in to answer this question.

More posts like this