I got the following files from a service provider while doing MiSeq sequencing. Can someone help me in demultiplexing and splitting this files? I have used 24 independent indexes for indexing.
Read1:
@130110_A5T23:1:1101:15646:1320:1#0/1
NAGTAAGATACAGTCTATCGGGTTTAAGTTATACAACATAGTACAGTACATTCATACCTACCTCTGCAATTAAATTTGGCGGTGTCATAATGTCTTTCAGCACAACTAAAAGAAAAGTTTAAAAGTGATATAAAGTTATCTTTTGCACTT
+
#>>AABFFFFFFGGGGGGGGGGCFGHHHHHHHHHHHHHHHHGFHHHHHHHHGHGHHHHHHGHHGHHHGHHHHHHHHHEHGGGEEFGHHHHFHHHGHHHHFHHHHGGGHHHHGGHHGHHHHHHHGHBGHHHHHHHHHFHFHHHHHGHFHHH
@130110_A5T23:1:1101:17282:1320:0#0/1
NGGGAGGATGGCTTGAGCCTAGAGGGTTGAGGCTGCAGTGAGCTGTGAGCATGCCATTGCACTCCAGCCTGGGCAACAGAGTGAGGCTCTGTCTCAAAAAAAAAAAAAAAAAAAAAAGAAATAAAATATAAGGGACATAAAATAAAGCAA
+
#>>AAA1A1B>F1A1FAFGCG0GBFEAAEHGBFCFFHHA1FEGGFFGGFFHHHGHHHHGHHHHHHHHHGHGGGHHGHHHFHGHGFGGHHHHHHHHHFGHHGGGEGGGGGGGGGGGCC.<<G0DGGFC:CCC0CC.::00:<00:9C####
Index
@130110_A5T23:1:1101:15646:1320:1#0/2
NTTGTATC
+
#>>AAAFF
@130110_A5T23:1:1101:17282:1320:0#0/2
NTTAGTCT
+
#1>>AAFF
2 answers
I recently wrote a small code for our miseq machine to demultiplex I1, R1, R2 reads assuming barcode reads are in the I1 file. It does a little more than exact matching. For barcodes reads not exactly matched with designed barcodes, which normally amount about 10% of total reads, edit distances with designed barcodes are calculated and a cut off is set by both user and the minimum edit distance among designed barcodes.
I came up with a solution for this problem a while back, although I didn't know about FastqMultx, and might have done something different now
Log in to answer this question.
-
How to split Illumina Hiseq 2000 paired-end fastq files?
written by Yuka Takemon •
-
Bwa Mem Strange Id
written by Nicolas Rosewick
-
Running Batch Files From Command Line
written by bioinfo
-
Bwa Run With Fastq File With Different Read Length
written by ttom
-
Trouble Passing Parameters To Bowtie
written by Nick
-
Help Needed For Formatting Fasta Headers
written by redspider19800915 •
-
How Can I Generate A Venn Diagram In R For A Given Csv File
written by Payal •
-
Error Using Samtools To View Content In .Sam File
written by soosus •
-
Unmapped Reads And Sequence Name
written by Stefano Berri
-
Error Running Blast2Sam.Pl
written by Rm
So all you have available is two FASTQ files, one for the index read and one for the single read, is that correct? Because if you have the basecall data we can run CASAVA. If these two files are all you have I can code up something for you Friday morning.
Hi Deedee, Thanks for you reply. Yah you are right, I have only the fastq files, not the raw files. And this is actually a paired end run. I have Read1, Read2 and Index ;these three fastq files. It will be of great help if you can write a code for me as I dont know to write codes for such conditions. Thanks and regards
Have you just tried using FastqMultx from ea-utils (http://code.google.com/p/ea-utils/wiki/FastqMultx)? You'll have to make a file specifying index:sample relationship, but it seems otherwise straightforward and supports paired-end demultiplexing.
+1 I didn't know about this tool. This looks like the best way to go.