Rna Structure Parsing Software

I am looking for a software which can parse the dot-bracket notation of RNA structure to element one, such as:

(((..(((........[[[[...))))))........]]]]
sssbbsssppppppppssssjjjssssssppppppppssss

rna structure

• 2,863 views • link

updated 12.6 years ago by AndreiR

• written 12.6 years ago by liu4gre

1 answer

Hello, I dont work with that, however, have you looked http://www.rnaparse.com/ ? Tools and links may contain something for you.

• 0 views • link

written 12.6 years ago by AndreiR

Hey, AndreiR can you please help me with this post?

Thanks in advance.

• 0 views • link

updated 6.6 years ago by Ram

• written 12.3 years ago by gauravdube007 •

More posts like this

RNA secondary structure for GRCH38 transcriptome
written 2.7 years ago by Saad Khan

Hi, I am wondering if I could download the dot-bracket notation rna-secondary structure data for the whole human transcriptome from somewhere. I know there are …
Is there a way to visualize RNA fold in R
written 2.9 years ago by Serij´s •

Hi, I am currently using the LncFinder-package in R to predict the secondary structure of RNA. I generated multiple dot-bracket-notations and I was wondering if …
Tools to visualize 2D RNA Heterodimer
written 4.5 years ago by nhaus •

Hello, I am currently predicting RNA structures using [RNAcofold][1]. I was wondering if any of you know a tool (preferably in R) which can be …
dot bracket to 2D structure
written 7.4 years ago by hac00837 •

How do I convert a dot bracket notation output from vienna RNA to a 2D structure. what is the easiest tool?
RNA secondary structure - Feature extraction
written 8.2 years ago by Manu Madhavan •

Hi All, For coding-non coding RNA identification (using Machine learning classifier), I would like to add features extracted from RNA secondary structure. I used RNAfold …
RNA Structure prediction using context free grammar
written 8.4 years ago by maria.sedsvit •

How is context free grammar utilised for RNA secondary structure prediction ? Is any code available that can predict the structure of input RNA sequence …
Convert ct file to dot bracket format
written 9.7 years ago by abdullahrenk •

Is there a program that can convert ct files to dot bracket format? I have RNA structures in ct format and would like to extract …
Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridizatio…
written 12.3 years ago by gauravdube007 •

Hello, I am interested in converting: Dot-Bracket notation format to Standard hybridization format. Example : Dot-Bracket notation - <pre><code>UGACGAUCAAAGGUGGGCCACU&GUGGCCAACUUCUAGUCAU ((((......((((.((((((.&)))))).))))...)))). </code></pre> to Standard …
To Calculate The Energy From Secondary Structure Dot Bracket Notation Of Rna
written 14.6 years ago by Angel •

Hi Biostar! I have the secondary structure of RNA in dot bracket notation. so, now with the same dot bracket notation I need to calculate …
How To Create Dot-Bracket Annotation For Rna With Pseudoknots
written 15.3 years ago by Niklas •

Dear all, I am trying to figure out a way of creating a Dot-Bracket structure for an RNA with arbitrary pseudoknots. The input data is …