Hello,

I am currently predicting RNA structures using RNAcofold.

I was wondering if any of you know a tool (preferably in R) which can be used to visualize 2D RNA structures. I have tried out different programs (e.g. RRNA) and they all work perfectly fine if you only have one dot bracket notation, but as soon as you have two, separated by a &, the programs fail.

This is for example one dot bracket notation that I would like to visualize:

ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG

..((((...))))...((...((...((..&............))...))...))..

The sequences before and after the & are the 2 sequences which form the heterodimer.

Any tips are greatly appreciated!