This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to calculate free energy of folding by mfold and deltaG of binding by RNAcofold for siRNA

I've been trying to design siRNA for a virus. So I am following the steps from an already published research paper. But I got stuck in a step. They calculated the free energy of folding with the target and deltaG of Binding for each considered siRNA. So, when I tried to reproduce the results from their data, I am getting different results. But, I think the results should be the same. I think I am doing something wrong.

  1. To calculate the free energy of folding they used the mfold web server.
  2. For deltaG of binding, they implemented the RNAcofold web server.

But in these server, I didn't find any such straight forward option.

This paper was published in 2014. That's why I am also guessing is there any chance of algorithm changes in the mentioned server? Or, maybe I am doing it in the wrong way? I have also attached a screenshot of the table and one siRNA and target for help.

siRNA target within mRNA: AGGGTGATAGCTGTTCTTCTAAT

guide RNA and passenger RNA: UAGAAGAACAGCUAUCACCCU and GGUGAUAGCUGUUCUUCUAAU

Screenshot of the Table

Would anyone please explain to me how they calculated the free energy of folding and deltaG of binding?????

Thanks in advance.

rna-seq

I am following the steps from an already published research paper

Which paper? Please provide a link or citation

is there any chance of algorithm changes in the mentioned server?

Yes, developers create new versions all the time, the current version of MFold is 3.6, if the paper reports (as expected) which version they used, you have some chance to reproduce their results. Also, parameters need to be clear.

from the paper:

The mfold web server contained UNAfold program (Zuker et al., 2003) was also used to predict the secondary structure formed between mRNA and RNAi guide strands.

There are no indication of version or parameters, it will be hard to reproduce.

What do you think? How they calculate the free energy of folding?

No idea, they are not providing any details or description, reviewers were relaxed about this.

0 answers

No answers yet.

Log in to answer this question.