Dear all,
I am trying to figure out a way of creating a Dot-Bracket structure for an RNA with arbitrary pseudoknots. The input data is a list of base pairs like this one:
5 17
6 16
7 15
10 20
11 19
The output should look like this:
....(((..[[...))).]]
AUGUACCGUCCUUUUGGAGG
Since there is no restriction on the pseudoknots there could also be a base pair 12 30 which would need a different set of brackets, e.g. { }.
Does anyone know an effective way of doing this? Any help would be appreciated!
Regards Nick
Ok, I just solved it :-)
I create a stack for each kind of brackets I use and for each new base pair I check if it crosses any of the base pairs on one stack. If it doesn't I put it on this stack and use the corresponding brackets, if not I move on to the next stack.
I don't know if it's the most efficient way but it's sufficient.
Hey, Niklas can you please help me with this post?
Thanks in advance.
•
written
by
gauravdube007 •
Log in to answer this question.
Closing as "no longer relevant", since you quickly answered your own question.