This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Is there a maximum length in EMBOSS needle?

I install BioPython and EMBOSS in my Ubuntu, and it works normally when I input 2 sequences (length <= 4000)

But I create new sequences (length = 10000) and test it, the error occurred.

Bio.Application.ApplicationError: Non-zero return code 1 from 'needle -outfile=needle.txt -asequence=alpha.faa -bsequence=beta.faa -gapopen=10 -gapextend=0.5', message 'Needleman-Wunsch global alignment of two sequences'

Is this occurred because of its length? If then how can I break this limit?

alignment
• 1,654 views • link
written by xien0114 • xien0114

Check that you don't have any error in your command/code (maybe show it). Another possibility is you may be running out of memory.

• 0 views • link
written by Jean-Karim Heriche Jean-Karim Heriche

http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/needle.html

A true Needleman Wunsch implementation like needle needs memory proportional to the product of the sequence lengths. For two sequences of length 10,000,000 and 1,000 it therefore needs memory proportional to 10,000,000,000 characters. Two arrays of this size are produced, one of ints and one of floats so multiply that figure by 8 to get the memory usage in bytes. That doesn't include other overheads. Therefore only use water and needle for accurate alignment of reasonably short sequences.

If you run out of memory, try using stretcher instead.

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Non-zero return code 127 from Needle
    written by Park • Park
    I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
  • Using needle command with no output to the terminal
    written by Jacob • Jacob
    I'm am using the needle command and would just like there to be no output to the terminal For example this is what I run …
  • Biopython Emboss Needle gives no output file
    written by weihan • weihan
    I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
  • alignment using needleman wunsch in biopython
    written by sumithrasank75 sumithrasank75
    I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
  • EMBOSS needle question
    written by mossig89 • mossig89
    After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • Emboss Needle From Biopython, No Output File
    written by Maria • Maria
    <p>I am trying to use emboss from <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec93'>biopython</a>, I copied into the python commandline the commands from the link above i.e : </p> <pre><code>&gt;&gt;&gt; …
  • The Biopython Needlecommandline Class Complains About Needle Returning Non-Zero
    written by jergosh jergosh
    <p>I'm trying to run needle using Biopython's NeedleCommandline. The two input files are tempfile.NamedTemporaryFiles.</p> <pre><code> cline = NeedleCommandline(asequence=gene_fasta.name, bsequence=chain_fasta.name, gapopen=10, gapextend=1, stdout=True) stdout, stderr = …
  • Global Pairwise Alignment For Long Sequence Throws Error In Python!!
    written by abhishekniroula7 abhishekniroula7
    <p>Hello there,</p> <p>I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …