This is a test version of Biostars. For the public version, visit https://www.biostars.org.
alignment using needleman wunsch in biopython

I want to align two sequnces in bipython using needleman wunsch algorithm

file1.faa:

>seq_1
gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg

file2.faa:

>seq_2
GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT

I have tried

from Bio.Emboss.Applications import NeedleCommandline
from Bio import AlignIO

needle_cline = NeedleCommandline(asequence="file1.faa", bsequence="file2.faa",gapopen=10, gapextend=0.5, outfile="needle.txt")

But the output file needle.txt does not get written. Can you help?

alignment
• 5,430 views • link
updated by Ram Ram • written by sumithrasank75 sumithrasank75

1 answer

It seems you only created the wrapper object for the function call. Assuming you have the EMBOSS toolkit installed, this means you still have to call the actual function to make Biopython execute the command. So after creating the wrapper object like this:

needle_cline = NeedleCommandline(asequence="file1.faa", bsequence="file2.faa",gapopen=10, gapextend=0.5, outfile="needle.txt")

you need to actually execute the function like this:

stdout, stderr = needle_cline()

This will create the output file and save any output of the command to the stderr and stdout streams to the respective variables.

• 1 views • link
updated by Ram Ram • written by utzermel utzermel

I did the above but I get an error

Bio.Application.ApplicationError: Non-zero return code 127 from 'needle -outfile=needle.txt -asequence=file1.faa -bsequence=file2.faa -gapopen=10 -gapextend=0.5', message '/bin/sh: needle: command not found'

I have installed emboss, so I guess it is a path problem. Can you suggest a fix?

• 0 views • link
updated by Ram Ram • written by sumithrasank75 sumithrasank75

If you are using a Linux operating system, you can append the EMBOSS executables to your path by creating a file entitled EMBOSS.sh (name doesn't matter, but it has to be .sh) in /etc/profile.d/

Make the contents of the file the following:

PATH=$PATH:/path/to/your/EMBOSS/executables
export PATH

Then save the file and restart the terminal you are using python from. For other operating systems I unfortunately don't know how to append things to the PATH, but is should be easy to find out by a simple google search.

• 0 views • link
updated by Ram Ram • written by utzermel utzermel

Log in to answer this question.

More posts like this
  • Non-zero return code 127 from Needle
    written by Park • Park
    I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
  • EMBOSS dosen't output file in biopython
    written by Thesnak • Thesnak
    I tried to execute this code using biopython but there is no file for output from Bio.Emboss.Applications import NeedleCommandline needle_cline=NeedleCommandline(r"C:\mEMBOSS\needle.exe",asequence="Sequence 1.txt",bsequence="Sequence 2.txt",gapopen=10,gapextend=0.5,outfile="output.txt") stdout,stderr = needle_cline() …
  • Is there a maximum length in EMBOSS needle?
    written by xien0114 • xien0114
    I install BioPython and EMBOSS in my Ubuntu, and it works normally when I input 2 sequences (length <= 4000) But I create new sequences …
  • Biopython Emboss Needle gives no output file
    written by weihan • weihan
    I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
  • can not get the alignment result from needle alignment
    written by Medhat Medhat
    I am using this script to compare to sequence and parse the result: ```py from Bio.Emboss.Applications import NeedleCommandline from Bio import AlignIO needle_cline = NeedleCommandline(asequence="a.fa", …
  • EMBOSS needle question
    written by mossig89 • mossig89
    After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • Emboss Needle From Biopython, No Output File
    written by Maria • Maria
    <p>I am trying to use emboss from <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec93'>biopython</a>, I copied into the python commandline the commands from the link above i.e : </p> <pre><code>&gt;&gt;&gt; …
  • Global Pairwise Alignment For Long Sequence Throws Error In Python!!
    written by abhishekniroula7 abhishekniroula7
    <p>Hello there,</p> <p>I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …