can not get the alignment result from needle alignment

I am using this script to compare to sequence and parse the result:

from Bio.Emboss.Applications import NeedleCommandline
from Bio import AlignIO

needle_cline = NeedleCommandline(asequence="a.fa",
                bsequence="b.fa",
                gapopen=10, gapextend=0.5, outfile="needle.txt")

filename= "needle.txt"
format = "emboss"

alignments = list(AlignIO.parse(filename, format))

when I try to print the results in the alignments list it gives me only part of the last line

like that

SingleLetterAlphabet() alignment with 2 rows and 2258 columns
TTGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAA...TCT ref
TGGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAA...T-- corr

Any idea?

sequence alignment

• 2,590 views • link

updated 4.0 years ago by Ram

• written 10.8 years ago by Medhat

1 answer

Consider checking the examples in the documentation for the MultipleSeqAlignment class returned by AlignIO.

I guess this might do what you want:

print alignments[:,:]

• 1 views • link

updated 6.7 years ago by Ram

• written 10.8 years ago by Kamil

I changed the method from parse to read like this

alignments = AlignIO.read(filename, format)
print alignments[:,:]

but, the result is the same

SingleLetterAlphabet() alignment with 2 rows and 2258 columns
TTGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAA...TCT ref
TGGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAA...T-- corr

any Idea?

• 0 views • link

updated 6.7 years ago by Ram

• written 10.8 years ago by Medhat

I figured it I need to add another loop to get the sequence

for alignment in AlignIO.parse(filename, format):
    for sequence in alignment:
        print(sequence.seq)

• 0 views • link

updated 6.7 years ago by Ram

• written 10.8 years ago by Medhat

More posts like this

Non-zero return code 127 from Needle
written 4.5 years ago by Park •

I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
EMBOSS dosen't output file in biopython
written 5.6 years ago by Thesnak •

I tried to execute this code using biopython but there is no file for output from Bio.Emboss.Applications import NeedleCommandline needle_cline=NeedleCommandline(r"C:\mEMBOSS\needle.exe",asequence="Sequence 1.txt",bsequence="Sequence 2.txt",gapopen=10,gapextend=0.5,outfile="output.txt") stdout,stderr = needle_cline() …
Biopython Emboss Needle gives no output file
written 9.5 years ago by weihan •

I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
Output EMBOSS Needle consensus sequence Biopython/Python 2.7
written 10.9 years ago by dmenning •

I have a working python script for EMBOSS Needle that takes the input from two files and outputs the expected paired alignment. ```py from Bio.Emboss.Applications …
alignment using needleman wunsch in biopython
written 11.2 years ago by sumithrasank75

I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
EMBOSS needle question
written 12.0 years ago by mossig89 •

After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
EMBOSS needle question
written 12.1 years ago by mossig89 •

hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
Emboss In Biopython Asequence And Bsequence
written 12.6 years ago by Maria •

In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
Emboss Needle From Biopython, No Output File
written 12.6 years ago by Maria •

I am trying to use emboss from <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec93'>biopython</a>, I copied into the python commandline the commands from the link above i.e : <pre><code>>>> …
Global Pairwise Alignment For Long Sequence Throws Error In Python!!
written 13.5 years ago by abhishekniroula7

Hello there, I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …