This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Non-zero return code 127 from Needle

I am struggling with running Needle. What did I do wrong?

from Bio.Emboss.Applications import NeedleCommandline
needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile)
stdout, stderr = needle_cline() print(stdout + stderr)
ApplicationError: Non-zero return code 127 from '/opt/anaconda3/envs/SmartBioCode/bin/needle -outfile=needle.txt -asequence=needle1.fasta -bsequence=needle2.fasta -gapopen=10.0 -gapextend=1.0', message 'usage: dirname string [...]'
emboss needle biopython
• 1,395 views • link
updated by seidel seidel • written by Park • Park

Please past text of your error message, not an image. The contents of an image cannot be indexed for their textual content and that makes it harder for people to come back to this question later on.

• 0 views • link
written by Alex Reynolds Alex Reynolds

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • EMBOSS dosen't output file in biopython
    written by Thesnak • Thesnak
    I tried to execute this code using biopython but there is no file for output from Bio.Emboss.Applications import NeedleCommandline needle_cline=NeedleCommandline(r"C:\mEMBOSS\needle.exe",asequence="Sequence 1.txt",bsequence="Sequence 2.txt",gapopen=10,gapextend=0.5,outfile="output.txt") stdout,stderr = needle_cline() …
  • Biopython Emboss Needle gives no output file
    written by weihan • weihan
    I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
  • can not get the alignment result from needle alignment
    written by Medhat Medhat
    I am using this script to compare to sequence and parse the result: ```py from Bio.Emboss.Applications import NeedleCommandline from Bio import AlignIO needle_cline = NeedleCommandline(asequence="a.fa", …
  • alignment using needleman wunsch in biopython
    written by sumithrasank75 sumithrasank75
    I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
  • EMBOSS needle question
    written by mossig89 • mossig89
    After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • Emboss Needle From Biopython, No Output File
    written by Maria • Maria
    <p>I am trying to use emboss from <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec93'>biopython</a>, I copied into the python commandline the commands from the link above i.e : </p> <pre><code>&gt;&gt;&gt; …
  • The Biopython Needlecommandline Class Complains About Needle Returning Non-Zero
    written by jergosh jergosh
    <p>I'm trying to run needle using Biopython's NeedleCommandline. The two input files are tempfile.NamedTemporaryFiles.</p> <pre><code> cline = NeedleCommandline(asequence=gene_fasta.name, bsequence=chain_fasta.name, gapopen=10, gapextend=1, stdout=True) stdout, stderr = …
  • Global Pairwise Alignment For Long Sequence Throws Error In Python!!
    written by abhishekniroula7 abhishekniroula7
    <p>Hello there,</p> <p>I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …