This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Emboss Needle From Biopython, No Output File

I am trying to use emboss from biopython, I copied into the python commandline the commands from the link above i.e : 

>>> from Bio.Emboss.Applications import NeedleCommandline
>>> needle_cline = NeedleCommandline(asequence="alpha.faa", bsequence="beta.faa", gapopen=10, gapextend=0.5, outfile="needle.txt")

I don't get any error message but the problem is that the file needle.txt is not created and when executing the code below I get an error as the needle.txt file can't be found: 

>>> from Bio import AlignIO
>>> align = AlignIO.read("needle.txt", "emboss")
>>> print(align)

Please any idea what is wrong here ? Note that the graphical interface Jemboss works well and I can align and see the output.

windows biopython
• 6,585 views • link
updated by Biostar Biostar • written by Maria • Maria

you need to add to first script

stdout,stderr=needle_cline()
• 0 views • link
written by Medhat Medhat

1 answer

The Code above give a command that have to be executed manually

• 0 views • link
written by Maria • Maria

Not only manually, you can also call the Commandline object you made with needle_cline()

• 136 views • link
written by David W David W

Log in to answer this question.

More posts like this
  • Non-zero return code 127 from Needle
    written by Park • Park
    I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
  • EMBOSS dosen't output file in biopython
    written by Thesnak • Thesnak
    I tried to execute this code using biopython but there is no file for output from Bio.Emboss.Applications import NeedleCommandline needle_cline=NeedleCommandline(r"C:\mEMBOSS\needle.exe",asequence="Sequence 1.txt",bsequence="Sequence 2.txt",gapopen=10,gapextend=0.5,outfile="output.txt") stdout,stderr = needle_cline() …
  • Is there a maximum length in EMBOSS needle?
    written by xien0114 • xien0114
    I install BioPython and EMBOSS in my Ubuntu, and it works normally when I input 2 sequences (length <= 4000) But I create new sequences …
  • Biopython Emboss Needle gives no output file
    written by weihan • weihan
    I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
  • can not get the alignment result from needle alignment
    written by Medhat Medhat
    I am using this script to compare to sequence and parse the result: ```py from Bio.Emboss.Applications import NeedleCommandline from Bio import AlignIO needle_cline = NeedleCommandline(asequence="a.fa", …
  • alignment using needleman wunsch in biopython
    written by sumithrasank75 sumithrasank75
    I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
  • EMBOSS needle question
    written by mossig89 • mossig89
    After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • Global Pairwise Alignment For Long Sequence Throws Error In Python!!
    written by abhishekniroula7 abhishekniroula7
    <p>Hello there,</p> <p>I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …