This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Biopython Emboss Needle gives no output file

I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook):

from Bio.Emboss.Applications import NeedleCommandline
needle_cline = NeedleCommandline(asequence="alpha.faa", bsequence="beta.faa", gapopen=10, gapextend=0.5, outfile="needle.txt")
print(needle_cline)

It returns: needle -outfile=needle.txt -asequence=alpha.faa -bsequence=beta.faa -gapopen=10 -gapextend=0.5

However, no output file named "needle.txt" is generated. All input files are present. No errors msg appear in the process. Anyone knows what went wrong? Thanks!

alignment
• 3,831 views • link
updated by Asaf Asaf • written by weihan • weihan

2 answers

You just created a needle command line object without actually running the program :)

To run the command, type:

stdout, stderr = needle_cline()
print(stdout + stderr)

The output file needle.txt should be right there for you. For more information, read the whole 6.4.5. section (EMBOSS needle and water) in the BioPython Tutorial and Cookbook.

• 0 views • link
written by Andrzej Zielezinski Andrzej Zielezinski

Thank you! However, when I type in 

stdout, stderr = needle_cline()

It returns:

Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Bio/Application/__init__.py", line 516, in __call__ stdout_str, stderr_str) Bio.Application.ApplicationError: Non-zero return code 127 from 'needle -outfile=needle.txt -asequence=alpha.faa -bsequence=beta.faa -gapopen=10 -gapextend=0.5', message '/bin/sh: needle: command not found'

Is there something wrong with PATH?

• 0 views • link
written by weihan • weihan

Probably. It can't find needle in default $PATH.

• 0 views • link
written by Asaf Asaf

Keep reading the cookbook, you should execute this line.

• 0 views • link
written by Asaf Asaf

Log in to answer this question.

More posts like this
  • Non-zero return code 127 from Needle
    written by Park • Park
    I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
  • EMBOSS dosen't output file in biopython
    written by Thesnak • Thesnak
    I tried to execute this code using biopython but there is no file for output from Bio.Emboss.Applications import NeedleCommandline needle_cline=NeedleCommandline(r"C:\mEMBOSS\needle.exe",asequence="Sequence 1.txt",bsequence="Sequence 2.txt",gapopen=10,gapextend=0.5,outfile="output.txt") stdout,stderr = needle_cline() …
  • Is there a maximum length in EMBOSS needle?
    written by xien0114 • xien0114
    I install BioPython and EMBOSS in my Ubuntu, and it works normally when I input 2 sequences (length <= 4000) But I create new sequences …
  • can not get the alignment result from needle alignment
    written by Medhat Medhat
    I am using this script to compare to sequence and parse the result: ```py from Bio.Emboss.Applications import NeedleCommandline from Bio import AlignIO needle_cline = NeedleCommandline(asequence="a.fa", …
  • alignment using needleman wunsch in biopython
    written by sumithrasank75 sumithrasank75
    I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
  • EMBOSS needle question
    written by mossig89 • mossig89
    After giving up on installing EMBOSS on windows platform, I installed it on Lubuntu after I copied and unziped the EMBOSS-6.5.7.tar.gz in my the library …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • Emboss Needle From Biopython, No Output File
    written by Maria • Maria
    <p>I am trying to use emboss from <a href='http://biopython.org/DIST/docs/tutorial/Tutorial.html#sec93'>biopython</a>, I copied into the python commandline the commands from the link above i.e : </p> <pre><code>&gt;&gt;&gt; …
  • The Biopython Needlecommandline Class Complains About Needle Returning Non-Zero
    written by jergosh jergosh
    <p>I'm trying to run needle using Biopython's NeedleCommandline. The two input files are tempfile.NamedTemporaryFiles.</p> <pre><code> cline = NeedleCommandline(asequence=gene_fasta.name, bsequence=chain_fasta.name, gapopen=10, gapextend=1, stdout=True) stdout, stderr = …