This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Using needle command with no output to the terminal

I'm am using the needle command and would just like there to be no output to the terminal

For example this is what I run

needle -asequence seq1.fna -bsequence seq2.fna -gapopen 0 -gapextend 2 -outfile file.needle          
Needleman-Wunsch global alignment of two sequences

And I would just like the line Needleman-Wunsch global alignment of two sequences to not print.

needle emboss silent
• 3,052 views • link
updated by Charles Plessy Charles Plessy • written by Jacob • Jacob

1 answer

The -auto option just does that. Quoting from the manual:

The -auto qualifier will turn off any prompting of the user. It will try to run the program with all the default settings that are defined in the ACD file. If a parameter does not have a default value and it is flagged as required, the program will stop and produce an error message.

• 0 views • link
written by Charles Plessy Charles Plessy

Log in to answer this question.

More posts like this
  • Non-zero return code 127 from Needle
    written by Park • Park
    I am struggling with running Needle. What did I do wrong? ``` from Bio.Emboss.Applications import NeedleCommandline needle_cline = NeedleCommandline("/opt/anaconda3/envs/SmartBioCode/bin/needle", asequence="needle1.fasta", bsequence="needle2.fasta", gapopen=10.0, gapextend=1.0, outfile="needle.txt") print(needle_cline.outfile) …
  • Needle error - cannot get second filename
    written by kaixas • kaixas
    Hi all, I'm trying to loop through my sequence list for `needle` command below: while IFS="," read -r c1 c2 do \ echo ${c1} ${c2}; …
  • Is there a maximum length in EMBOSS needle?
    written by xien0114 • xien0114
    I install BioPython and EMBOSS in my Ubuntu, and it works normally when I input 2 sequences (length <= 4000) But I create new sequences …
  • Biopython Emboss Needle gives no output file
    written by weihan • weihan
    I'm learning Emboss Needle from biopython to align two sequences. When I type in the following comments(used as an example from Biopython cookbook): from Bio.Emboss.Applications …
  • Needle Crashing on Specific Sequences
    written by juanfelipe2005 • juanfelipe2005
    Given two fasta files, attempting alignment: ==> seq1.fasta <== >seq1 DVARNTGAYTS ==> seq2.fasta <== >seq2 EVACNTGAYTS **Both needle and stretcher crash**: $/usr/local/bin/needle seq1.fasta seq2.fasta needle.out …
  • alignment using needleman wunsch in biopython
    written by sumithrasank75 sumithrasank75
    I want to align two sequnces in bipython using needleman wunsch algorithm `file1.faa`: ``` >seq_1 gagtcccagctgtgcctgactaaccgtgtttctcttgtatctaggagtgctcccaccccagcccgttgctgcccagctgtttaattgagttgtcatatgttaataacggtatattggaacactgtataacaccaacacactcgagtctttcaagactgcagataagaagctccttttggaacaagcagcaaatgaggttagctg ``` `file2.faa`: ``` >seq_2 GAGTCCCAGCTGTGCCTGACTAACCGTGTTTCTCTTGTATCTAGGAGTGCTCCCACCCCAGCCCGTTGCTGCCCAGCTGTTTAATTGAGTTGTCATATGTTAATAACGGTATTGGAACACTGTATAACACCAACACACTCGAGTCTTTCAAGACTGCAGATAAGAAGCTCCTTTTGGAACAAGCAGCAAATGAGGTTAGCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCGTTCTCATCT ``` I have tried …
  • EMBOSS needle question
    written by mossig89 • mossig89
    hello I'm new to biopython and trying to run the example provided by the biopython documentation **section 6.4.5 EMBOSS needle and water**: ``` from Bio.Emboss.Applications …
  • Emboss In Biopython Asequence And Bsequence
    written by Maria • Maria
    <p>In biopython emboss applications, is it possible that asequence and bsequence attributes of needle/watercommandline object be a variable instead of fasta file ? i.e I …
  • The Biopython Needlecommandline Class Complains About Needle Returning Non-Zero
    written by jergosh jergosh
    <p>I'm trying to run needle using Biopython's NeedleCommandline. The two input files are tempfile.NamedTemporaryFiles.</p> <pre><code> cline = NeedleCommandline(asequence=gene_fasta.name, bsequence=chain_fasta.name, gapopen=10, gapextend=1, stdout=True) stdout, stderr = …
  • Global Pairwise Alignment For Long Sequence Throws Error In Python!!
    written by abhishekniroula7 abhishekniroula7
    <p>Hello there,</p> <p>I am performing pairwise global alignment using Emboss Needleman-Wunsch algorithm via python script. The script runs pretty well with shorter sequences but it …