This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How Do I Convert Fa Files To Bed Format?

how do I convert fa files to bed format?

fasta bed
• 42,264 views • link
updated by shelkmike shelkmike • written by Keziah • Keziah

question asked without sufficient brain activity = downvote

• 0 views • link
written by Michael Dondrup Michael Dondrup

@michael my guess would be that it is due to a confusion of formats & their purposes. happens to the best!

• 0 views • link
written by Deniz Deniz

a confusion that could be avoided with minimal research. Still, I believe it is a good thing to tell people why I down-voted, but I'm not going write an essay each time investing more effort than the OP, so it will be brief and to the point. If that offends someone, so be it.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Noahaus, your script gives different results than faidx does..... I believe faidx as it is a community tool thats been around a while, you may want to double check your script (or maybe file a bug with faidx),

• 0 views • link
written by john.major • john.major

5 answers

You can't.

A Fa/Fasta file describes a sequence of DNA/Protein:

>Name
ATAGCTACGATTACGACGTACG
ATCGATCGATGCATCAGCTACT
AACTAGTCGATGATGCATACG...

A bed file describes some features mapped on a genome/sequence:

chr1  786 9879 gene1
chr2  486 979  gene2

The only thing you can do is saying that the BED contains only one feature: your sequence:

Name  0  1098 Name
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

This is a good, though slightly misguided question. If you want to make a BED file from a FASTA sequence, you might do something like this:

  1. Find your FASTA sequence. We'll use human hemoglobin beta as an example.
  2. Use BLAST to align your sequence to the human reference genome.
  3. In the alignment example above, you would pick the genomic alignment, not transcript, and choose "subject" start and end positions. Note that this example has 3 exons, so your BED file start would be 5186957 and end would be 5188159.
  4. Create a BED file using the chromosome (11 in above example), chromstart (5186957), chromend (5188159), and a name for your gene (HBB). You can then upload this as a custom track in the UCSC genome browser.
  5. You will probably want to add introns to your gene structure, so at this point you can the GenePred format instead of BED. This allows you to specify the strand, as well as introns, exons, and transcription factor binding sites.
• 1 views • link
written by Matt Shirley Matt Shirley

Uh, align it to a genome?

• 0 views • link
written by Madelaine Gogol Madelaine Gogol

And some aligners such as BLAT will output alignments in BED format...

• 0 views • link
written by Malachi Griffith Malachi Griffith

@malachig - I don't think BLAT outputs BED. The -out=type is one of: psl - Default. Tab separated format, no sequence pslx - Tab separated format with sequence axt - blastz-associated axt format maf - multiz-associated maf format sim4 - similar to sim4 format wublast - similar to wublast format blast - similar to NCBI blast format blast8- NCBI blast tabular format blast9 - NCBI blast tabul

• 0 views • link
written by Casey Bergman Casey Bergman 
cat $fastafile | awk '$0 ~ "^>" {name=substr($0, 2); printf name"\t1\t"} $0 !~ "^>" {printf length($0)"\t"name"\n"}'

If each fasta sequence spans several lines, substitute the awk script by:

BEGIN{totallen=-1;} $0 ~ "^>" {if (totallen!=-1) print totallen"\t"name; name=substr($0, 2); printf name"\t1\t"; totallen=0} $0 !~ "^>" {totallen=totallen+length($0);} END{if (totallen!=-1) print totallen"\t"name;}'
• 1 views • link
written by cpcantalapiedra cpcantalapiedra

Doesn't bed format start with zero as the first base?

• 0 views • link
written by KevinL • KevinL

Old question, but in the spirit of good science I will post a script that takes any genome fasta file and creates a genome BED file. Very niche but I don't think there is a good converter out there quite yet.

https://github.com/noahaus/Micellaneous-Tools/blob/master/genome2bed.py

I'd read the comments in the script before beginning.

• 1 views • link
written by noahaus • noahaus

Many thanks for this. Strange as it may seem, I've been looking for a simple way to do this for a while. There were a couple of minor issues with the script (the annotation length includes line feeds, and the last line fails to be included unless there's an extra line feed at the end - these may be OS specific) but it does the job perfectly.

• 1 views • link
written by mah1 • mah1

Log in to answer this question.

More posts like this