This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to resolve the warning message in detectRUNS on R software

Hi,

I am using detectRUNS package on R software to visualize my roh data generated by bcftools roh option. I used these commands on R but the second command gives a warning message

savedRunFile <- system.file("extdata", "input_roh.txt", package="BCFtools")
runs <- readExternalRuns(inputFile = savedRunFile, program = "BCFtools")
Loading file from BCFtools
Warning message:
In file(con, "r") :
  file("") only supports open = "w+" and open = "w+b": using the former

Kindly guide me about the warning message. I am a novice to R and don't know what exactly this warning line is and how to resolve the issue. Any help is highly appreciated.

Thanks in advance

bcftools detectruns roh r
• 1,435 views • link
updated by Ram Ram • written by taniamahmood38 • taniamahmood38

1 answer

Your system.file command is telling R to look for the input_roh.txt file within the BCFtools library folder, which you probably didn't mean to do. Try changing the inputFile argument of readExternalRuns to that file name instead. This assumes the file is in the working directory of R, if not you need to include a relative or absolute path to it.

• 0 views • link
written by rpolicastro rpolicastro

Log in to answer this question.

More posts like this
  • Data Import Issue detectRUNS R
    written by Whirlingdaf • Whirlingdaf
    I am running into an issue when importing data with detectRUNS in R. The following commands to import PLINK files have not been successful, and …
  • Gene enrichment analysis R studio error
    written by iamsmor • iamsmor
    Hi everyone I started gene enrichment analysis but I am started with R error mentioned below. ``` > library(clusterProfiler) library(GSEABase) library(org.Hs.eg.db) > filename<- "c7.all.v7.1.entrez.gmt" gmtfile …
  • Position specific scoring matrix, protr package
    written by nonaa.lucin • nonaa.lucin
    I'm trying to calculate "PSSM feature" using protr package. I tried to adapt the example in the documentation to fit my data, but I always …
  • "Error in read.table(decoder.file, header = TRUE, stringsAsFactors = FALSE) : no lines available in…
    written by sc@791 • sc@791
    Hi! I am using JunctionSeq first time and not very expert in R language. While running JunctionSeq analysis I am getting an error in reading …
  • scimpute problem: error in read table
    written by hsu • hsu
    I used scImpute to normalize my data in R. code is : scimpute(count_path = system.file("extdata","GeneCounts_3F-A37B12C16D21.csv", package ="scImpute" ), infile="csv", outfile="csv", out_dir="./", labeled = FALSE, drop_thre= …
  • File open mode error in R
    written by dengziqi1234 • dengziqi1234
    Hello！I'm using a package from github. I've installed it. But when i follow the guideline. I met a error about opening file. require(rmotifx) rmotifx fg.path …
  • error for toGRanges
    written by jolin0701-dy jolin0701-dy
    I'd like to use ChIPpeakAnno to do downstream analysis after peak calling by macs2. But I got some error for toGRanges to upload my results …
  • using R4RNA package in R
    written by dnyanepooja138 • dnyanepooja138
    Hi, I am trying to generate a general framework for the analysis of RNA secondary structure using R4RNA package in R . But when I …
  • Getgeo Error
    written by nazaninhoseinkhan nazaninhoseinkhan
    <p>Hi all, I've just started to import gene expression data sets in R. When I try to import data using this command:</p> <pre><code>gds&lt;-getGEO(filename=system.file("extdata/GDS2478.soft.gz",package="GEOquery")) </code></pre> <p>I …
  • Seqinr Cannot Recognize ">" Character In File
    written by Partha • Partha
    <p>i have a fasta file of nucleic acid sequences with sequences beginning like </p> <pre><code>&gt;YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG AAATGA </code></pre> …