This is a test version of Biostars. For the public version, visit https://www.biostars.org.
error for toGRanges

I'd like to use ChIPpeakAnno to do downstream analysis after peak calling by macs2.

But I got some error for toGRanges to upload my results from macs2.

macs <- system.file("/Users/macs2", "/Users/macs2/cz3Rip_vs_cz1Inp_peaks.xls", package="ChIPpeakAnno")

macsOutput <- toGRanges(macs, format="MACS")

Error in read.table(data, header = header, ..., nrows = 5) : no lines available in input In addition: Warning message: In file(file, "rt") : file("") only supports open = "w+" and open = "w+b": using the former

I also tried broadPeak, but still got the error.

Any suggestions?

Thanks so much~~~

chip-seq
• 2,777 views • link
updated by igor igor • written by jolin0701-dy jolin0701-dy

1 answer

You don't need system.file if you know the path. Try:

macs <- "/Users/macs2/cz3Rip_vs_cz1Inp_peaks.xls"

Also, give a broadPeak, not xls file.

• 1 views • link
written by igor igor

Log in to answer this question.

More posts like this
  • upload sc rna seq file into R
    written by sandy • sandy
    Hello everyone, I meet a question to upload my scrna seq file to R. My data file is dge.txt.gz file. I used code `sample<- read.table("my/data/dir" …
  • Gene enrichment analysis R studio error
    written by iamsmor • iamsmor
    Hi everyone I started gene enrichment analysis but I am started with R error mentioned below. ``` > library(clusterProfiler) library(GSEABase) library(org.Hs.eg.db) > filename<- "c7.all.v7.1.entrez.gmt" gmtfile …
  • MACS: peak calling from snATAC data
    written by abiuma • abiuma
    Hi, I followed this tutorial to create the object Vis (https://satijalab.org/signac/articles/pbmc_vignette.html). From the object created here, I have been trying the peak calling from signac …
  • "Error in read.table(decoder.file, header = TRUE, stringsAsFactors = FALSE) : no lines available in…
    written by sc@791 • sc@791
    Hi! I am using JunctionSeq first time and not very expert in R language. While running JunctionSeq analysis I am getting an error in reading …
  • Error in DESeq analysis directory argument - No such file or directory
    written by AW • AW
    Hello, I'm using DESeq2 for RNA-Seq data analysis. Everything looks great but I get an error about my directory at the final step even though …
  • scimpute problem: error in read table
    written by hsu • hsu
    I used scImpute to normalize my data in R. code is : scimpute(count_path = system.file("extdata","GeneCounts_3F-A37B12C16D21.csv", package ="scImpute" ), infile="csv", outfile="csv", out_dir="./", labeled = FALSE, drop_thre= …
  • ChIPpeakAnno toGRanges error
    written by tarek.mohamed tarek.mohamed
    Dear All, I am trying to use ChIPpeakAnno package to annotate peaks generated by MACS2. First, I tried to convert my peaks file to GRange …
  • File open mode error in R
    written by dengziqi1234 • dengziqi1234
    Hello！I'm using a package from github. I've installed it. But when i follow the guideline. I met a error about opening file. require(rmotifx) rmotifx fg.path …
  • Getgeo Error
    written by nazaninhoseinkhan nazaninhoseinkhan
    <p>Hi all, I've just started to import gene expression data sets in R. When I try to import data using this command:</p> <pre><code>gds&lt;-getGEO(filename=system.file("extdata/GDS2478.soft.gz",package="GEOquery")) </code></pre> <p>I …
  • Seqinr Cannot Recognize ">" Character In File
    written by Partha • Partha
    <p>i have a fasta file of nucleic acid sequences with sequences beginning like </p> <pre><code>&gt;YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG AAATGA </code></pre> …