This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Seqinr Cannot Recognize ">" Character In File

i have a fasta file of nucleic acid sequences with sequences beginning like 

>YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding
ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT
AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC
GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG
AAATGA

but the command in R 

read.fasta(file = system.file("x.fa", package = "seqinr"), 
+            seqtype = "DNA",  as.string = FALSE, forceDNAtolower = TRUE,
+            set.attributes = TRUE, legacy.mode = TRUE, seqonly = FALSE, strip.desc =   FALSE)
Error in read.fasta(file = system.file("x.fa", package = "seqinr"),  : 
  no line starting with a > character found
In addition: Warning message:
In file(con, "r") :
  file("") only supports open = "w+" and open = "w+b": using the former

i have tried with many other files in my pc where DNA or amino acid sequences are there. but it cannot find the ">" character.

please help

fasta
• 8,809 views • link
updated by Michael Dondrup Michael Dondrup • written by Partha • Partha

Edited to make question readable. Please format code and sequences by indenting lines with 4 spaces in future.

• 0 views • link
written by Neilfws Neilfws

Also, as seen in the answers below, question title is misleading. Problem is nothing to do with seqinr not recognising ">" - it's that it can't find the file.

• 0 views • link
written by Neilfws Neilfws

2 answers

Part of your problem is that you have copy-pasted the read.fasta() command from somewhere, without understanding what it does.

The part which reads:

file = system.file("x.fa", package = "seqinr")

is looking for a file named ""x.fa" distributed with the seqinr package. There is no such file, so the command fails - admittedly, with a rather confusing error message.

If you have saved your own fasta file and called it "x.fa", then all you need is:

read.fasta("x.fa")

Assuming that the file is in the directory from which you are running R.

I think you need to take some time to learn the basics of R and in particular, how to interpret the contents of command help pages.

• 3 views • link
written by Neilfws Neilfws

Your command call is wrong, possibly, dont use 'system.file'. Simply set your file like 'file = x.fa' and try again.

• 2 views • link
written by Michael Dondrup Michael Dondrup

Log in to answer this question.

More posts like this