This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Getgeo Error

Hi all, I've just started to import gene expression data sets in R. When I try to import data using this command:

gds<-getGEO(filename=system.file("extdata/GDS2478.soft.gz",package="GEOquery"))

I get this error:

Error in read.table(con, sep = "\t", header = FALSE, nrows = nseries) : 
  invalid 'nlines' argument
In addition: Warning messages:
1: In file(fname, "r") :
  file("") only supports open = "w+" and open = "w+b": using the former
2: In file(con, "r") :
  file("") only supports open = "w+" and open = "w+b": using the former
3: In file(fname, "r") :
  file("") only supports open = "w+" and open = "w+b": using the former

I've searched internet for a useful guide, but unfortunately I have not been successful so far. I will appreciate any help. Nazanin

geo bioconductor
• 4,584 views • link
updated by Sean Davis Sean Davis • written by nazaninhoseinkhan nazaninhoseinkhan

Edited tags for you. Trust me, "question" is not a useful tag :)

• 0 views • link
written by Neilfws Neilfws

2 answers

I suspect that you are copy-pasting from an old version of the GEOquery tutorial and the file GDS2478.soft.gz does not exist on your system.

Some suggestions:

  • the example GDS in the latest version of GEOquery is GDS507.soft.gz - try that instead
  • find the directory GEOquery/extdata on your system and see what example data files it contains
  • get the data direct from GEO using getGEO("GDS2478") (or another GEO identifier)
• 444 views • link
written by Neilfws Neilfws

I admit, the error is not very clear--I'll have to fix that. You are telling GEOquery to get a file from your disk that does not exist. To do what you want to do, try this:

gds = getGEO('GDS2478')
• 146 views • link
written by Sean Davis Sean Davis

Log in to answer this question.

More posts like this
  • How to resolve the warning message in detectRUNS on R software
    written by taniamahmood38 • taniamahmood38
    Hi, I am using detectRUNS package on R software to visualize my roh data generated by bcftools roh option. I used these commands on R …
  • Gene enrichment analysis R studio error
    written by iamsmor • iamsmor
    Hi everyone I started gene enrichment analysis but I am started with R error mentioned below. ``` > library(clusterProfiler) library(GSEABase) library(org.Hs.eg.db) > filename<- "c7.all.v7.1.entrez.gmt" gmtfile …
  • "Error in read.table(decoder.file, header = TRUE, stringsAsFactors = FALSE) : no lines available in…
    written by sc@791 • sc@791
    Hi! I am using JunctionSeq first time and not very expert in R language. While running JunctionSeq analysis I am getting an error in reading …
  • scimpute problem: error in read table
    written by hsu • hsu
    I used scImpute to normalize my data in R. code is : scimpute(count_path = system.file("extdata","GeneCounts_3F-A37B12C16D21.csv", package ="scImpute" ), infile="csv", outfile="csv", out_dir="./", labeled = FALSE, drop_thre= …
  • File open mode error in R
    written by dengziqi1234 • dengziqi1234
    Hello！I'm using a package from github. I've installed it. But when i follow the guideline. I met a error about opening file. require(rmotifx) rmotifx fg.path …
  • error for toGRanges
    written by jolin0701-dy jolin0701-dy
    I'd like to use ChIPpeakAnno to do downstream analysis after peak calling by macs2. But I got some error for toGRanges to upload my results …
  • using R4RNA package in R
    written by dnyanepooja138 • dnyanepooja138
    Hi, I am trying to generate a general framework for the analysis of RNA secondary structure using R4RNA package in R . But when I …
  • Getgeo Error
    written by nazaninhoseinkhan nazaninhoseinkhan
    <p>Hi</p> <p>I turned off the firewall. This time the command <code>gds = getGEO('GDS2478')</code> resulted in the following error:</p> <pre><code>Using locally cached version of GDS2478 found …
  • Getgeo Error
    written by nazaninhoseinkhan nazaninhoseinkhan
    <p>Hi Thanks for comments, but the problem has not been solved yet. When I type this command: gds = getGEO('GDS2478'), I get the following error:</p> …
  • Seqinr Cannot Recognize ">" Character In File
    written by Partha • Partha
    <p>i have a fasta file of nucleic acid sequences with sequences beginning like </p> <pre><code>&gt;YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG AAATGA </code></pre> …