This is a test version of Biostars. For the public version, visit https://www.biostars.org.
dndscv Error: can't change refdb file

I want to find driver mutations so I am trying to use dndscv tool. But, I am permanently getting this error

library(dndscv)
Warning message:
replacing previous import ‘Biostrings::translate’ by ‘seqinr::translate’ when loading ‘dndscv’

data("dataset_simbreast", package="dndscv")
dndsout = dndscv(mutations, refdb="refcds_hg19.rda", cv=NULL)
[1] Loading the environment...
Error in readChar(con, 5L, useBytes = TRUE) : cannot open the connection
In addition: Warning message:
In readChar(con, 5L, useBytes = TRUE) :
  cannot open compressed file 'refcds_hg19.rda', probable reason 'No such file or directory'

But, 'refcds_hg19.rda' is present.

Does anyone know how I can solve this error?

r dndscv
• 1,417 views • link
updated by zx8754 zx8754 • written by 1035655101 • 1035655101

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • htShinyExample-5.3 - not working
    written by bioinfo bioinfo
    We were trying to create click action to obtain data from another dataframe using `row_index` and `column_index` from the main Oncoprint plot. For this, we …
  • h5ad cellxgene to R
    written by firestar firestar
    I am trying to bring this [small dataset](https://cellxgene.cziscience.com/collections/1ca90a2d-2943-483d-b678-b809bf464c30) (1496 cells, 43MB) from cellxgene. **1 R SeuratDisk** h5ad to h5seurat and then to seurat. ```r library(SeuratDisk) …
  • error in Bioconductor getBM
    written by nitandressa • nitandressa
    Hello everyone! so, I'm trying to retireve some information from biomaRt and just found this error: > library(biomaRt) > ensembl = useMart(host='http://sep2019.archive.ensembl.org', biomart='ENSEMBL_MART_ENSEMBL', dataset='hsapiens_gene_ensembl') > …
  • dNdScv error: Zero coding substitutions found in this dataset
    written by zizigolu zizigolu
    Hi, I have a set of whole genome sequencing data, I want to find driver mutations so I am trying to use dndscv tool. But, …
  • Some packages are not working in the latest version of Bioconductor
    written by laith_mbiologist • laith_mbiologist
    Hi Guys I am new to R and I have recently downloaded the latest version of R and bioconductor. My aim is to work on …
  • ELMER package errors
    written by justa.dk • justa.dk
    Hello guys, I'm trying to preapre an input data for ELMER, using the recommended function data <- createMAE(exp = expr.df, + met = methylation.data.all, + …
  • EXCAVATOR Not working
    written by koenhendriks89 • koenhendriks89
    Hi Fellow Bioinformaticians, Hopefully you can help me with this problem regarding the EXCAVATOR CNV calling tool. When I run EXCAVATOR the on screen log …
  • minfiData error using MINFI Package for analysis illumina 450k bead chip data
    written by behrouz.gh • behrouz.gh
    Hello, I am learning R using R studio, I am trying to learn DNA methylation data analysis using MINFI package, I have installed the package, …
  • Problem In Connecting Cran R Site
    written by Nitin Nitin
    <p>Hello,</p> <p>I m trying to install R packages via CRAN mirror sites..But i am getting Following error</p> <pre><code>Type 'demo()' for some demos, 'help()' for on-line …
  • Seqinr Cannot Recognize ">" Character In File
    written by Partha • Partha
    <p>i have a fasta file of nucleic acid sequences with sequences beginning like </p> <pre><code>&gt;YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG AAATGA </code></pre> …