Correct Trimmomatic adapter sequence file to use?
Hi,
I was told by the sequencing core that my mRNA libraries were prepared with the TruSeq Dual index adapter. They gave me two different sequences:
Index 1 (i7) Adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG
Index2 (i 5) Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
I was wondering which Trimmomatic adapter .fasta file to use?
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
RNASeq: Confused about adapters with barcodes and seq company's filtering
written by Davor •
-
Trimming smRNA seq adaptors
written by Matar •
-
how to know what adapter sequences to trim for RNA-seq?
written by lunarskye222 •
-
How to remove Illumina TruSeq Index adapters reverse (R2 reads )
written by Info.shi •
-
illumina adapter specifying and removing using fastp
written by Mehmet
-
Trimming customed adaptor sequences with trimmomatic
written by 1215045934 •
-
Which adapters to use for trimming?
written by whb •
-
Dual indexing i5/i7 with ATAC-seq
written by e.antunes •
-
Removing Illumina Single End PCR Primers and TruSeq Adapters
written by serpalma.v •
-
trim_galore finds a different adaptor than the one I expected...
written by blur
if it is possible for you, use cutadapt and define your own adapters for it to remove them. Although you can create a fasta file includes your adapters for Trimmomatic