This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to remove Illumina TruSeq Index adapters reverse (R2 reads )

I used Ilumina TruSeq the Illumina TruSeq Index Adapters. I have paired-end data I was successfully able to remove the index adapter from R1 (Forward reads).

TruSeq_Index_Adapter reverse compliment

  1. cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

TruSeq_Index_Adapter

  1. cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -A GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

My both approach only remove the adapter from R1 (Forward reads) while R2 (reverse reads) have adapters I tried to understand the mechanism of sequencing and I get confused so I tried both.

If anybody can advise or suggest me regarding this issue I will be very thankful!

illumina adapter sequence truseq

In Illumina sequencing adapter sequence should only be present at 3'-end of the reads (unless you have adapter dimers, which you don't want anyway). Once the core adapter sequence (before the index that you highlighted above) is found then trimming programs are going to remove everything to the 3' all the way to the end.

Unless you have short inserts you will not see the adapter at 3'-end of sequence.

Thank you so much for quick response if I understand you well is it I need to specify maximum base pair of adapter to trim. And I was wounding then why reverse sequence shows adapter content.

Thank you so much for your explanation again.

Can you post an example of what you are referring to? Normally trimming programs should check reverse complements of sequences they are looking at but I am not a cutadapt user so not familiar with that specific program.

0 answers

No answers yet.

Log in to answer this question.