This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Custom sequences vs supplied sequences in trimmomatric

I would like to cut adapters in my PE data set with trimmomatic. The sequencing facility supplied two adapter sequences with the data:

Universal adapter:

5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

Indexed adapter:

5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG-3'

The universal adapter is the same as PrefixPE/1 in supplied with trimmomatic file TruSeq2-PE. However there is nothing looking like Indexed adapter. According to trimmomatic manual there are two modes of trimming: 'simple' and 'palindrome'. Naming of the sequences in supplied .fa file affects how they are used:

For 'Palindrome' clipping, the sequence names should both start with 'Prefix', and end in '/1' for the forward adapter and '/2' for the reverse adapter. All other sequences are checked using 'simple' mode. Sequences with names ending in '/1' or '/2' will be checked only against the forward or reverse read. Sequences not ending in '/1' or '/2' will be checked against both the forward and reverse read. If you want to check for the reverse-complement of a specific sequence, you need to specifically include the reverse-complemented form of the sequence as well, with another name.

Provided that I have only listed above two sequences and no information about the other adapters/primers which were used during the library preparation/sequencing, how my .fa file with adapters should look like for trimmomatic?

adapters trimming trimmomatic

1 answer

Trimmomatic's manual also says:

With 'simple' trimming, each adapter sequence is tested against the reads, and if a sufficientlyaccurate match is detected, the read is clipped appropriately.

So, I believe you simply need to append:

>IndexAdapter

GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

into your TruSeq2-PE.fa file.

Log in to answer this question.