This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove adpater from reads

Hello

I need advice on adapter trimming. I removed the Ilumina small RNA 3' adapter from my forward sequence and Ilumina Universal adapter from the reverse strand (using cutadapt). Used the adpater information from https://eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf. But still could see the adapter not being removed as shown below in the fastQC report. Am I using the wrong adapter information or missing any step?

¨Forward adapter

cutadapt -a ATCTCGTATGCCGTCTTCTGCTTG -o output.fastq 24_1.fastq ## remove adapter from forward strand

Reverse adapter

cutadapt -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -o output2.fastq 24_2.fastq ## remove adapter from reverse strand

Thanks

Priya

trimming adpater cutadapt
• 1,619 views • link
updated by gb gb • written by priya.bmg • priya.bmg

It appears that you have very short inserts and cutadapt is not making the initial matches. I am not a cutadapt user but you will need to decrease the initial seed match.

With bbduk.sh from BBMap suite you can try:

bbduk.sh -Xmx4g in=file.fastq out=trimmed.fastq literal=ATCTCGTATGCCGTCTTCTGCTTG,AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT  k=8 ktrim=r
• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this