Cross-posted from the github cutadapt page since there have been no responses from the author of cutadapt since November 2025.

I am working with paired-end ITS data and while I have no problem removing forward adapters, following the command from this link, no matter what I put for my reverse primer after the -A flag, I always get primers left over, whereas forward primers in fowrard reads and reverse primer in forward reads are successfully removed.

Here are my primers:

FWD <- "CTTGGTCATTTAGAGGAAGTAA"
REV <- "GCTGCGTTCTTCATCGATGC"

> FWD.orients <- allOrients(FWD); FWD.orients
                 Forward               Complement                  Reverse                  RevComp 
"CTTGGTCATTTAGAGGAAGTAA" "GAACCAGTAAATCTCCTTCATT" "AATGAAGGAGATTTACTGGTTC" "TTACTTCCTCTAAATGACCAAG" 

> REV.orients <- allOrients(REV); REV.orients
               Forward             Complement                Reverse                RevComp 
"GCTGCGTTCTTCATCGATGC" "CGACGCAAGAAGTAGCTACG" "CGTAGCTACTTCTTGCGTCG" "GCATCGATGAAGAACGCAGC"

During the cleaning, I found that my reverse primer is matching more to the reverse complement so in my command line code (I cannot get cutadapt to work in R) I use the following:

for r1 in *_R1.fastq; do r2=${r1/_R1.fastq/_R2.fastq}; sample=${r1%%_R1.fastq}; /home/chauk/.local/bin/cutadapt \
-a CTTGGTCATTTAGAGGAAGTAA...GCATCGATGAAGAACGCAGC -A GCTGCGTTCTTCATCGATGC...TTACTTCCTCTAAATGACCAAG \
-n 2 -o output2/${sample}_R1_cut.fastq -p output2/${sample}_R2_cut.fastq $r1 $r2; done

I have also tried other variations of primers but no matter what I always get the following output (example shown):

                 Forward Complement Reverse RevComp
FWD.ForwardReads       0          0       0       0
FWD.ReverseReads    1720       1715    1707   18415
REV.ForwardReads       0          0       0       0
REV.ReverseReads   20959       1826    1728    1744

I am clearly not using the correct primer order after the -A flag but I don't know what other combination I can even do to make this work.

Just for extra context, here are the primer counts before any filtering (not using filtN because I end up losing like 90% of my reads for all samples):

 rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = fnFs[[1]]), 
       FWD.ReverseReads = sapply(FWD.orients,primerHits, fn = fnRs[[1]]), 
       REV.ForwardReads = sapply(REV.orients, primerHits,fn = fnFs[[1]]), 
       REV.ReverseReads = sapply(REV.orients, primerHits, fn = fnRs[[1]]))

                 Forward Complement Reverse RevComp
FWD.ForwardReads   27211          0       0       0
FWD.ReverseReads    1720       1715    1707   18415
REV.ForwardReads       0          0       0   26660
REV.ReverseReads   26766       1826    1728    1744

Then I have decided to update my code to the following:

for r1 in *_R1.fastq; do r2=${r1/_R1.fastq/_R2.fastq}; sample=${r1%%_R1.fastq}; /home/chauk/.local/bin/cutadapt \
-g CTTGGTCATTTAGAGGAAGTAA -a GCATCGATGAAGAACGCAGC -G GCTGCGTTCTTCATCGATGC \
-A TTACTTCCTCTAAATGACCAAG -n 2 -o output2/${sample}_R1_cut.fastq -p output2/${sample}_R2_cut.fastq $r1 $r2; done

Which, when I check again for primers produces the following:

rbind(FWD.ForwardReads = sapply(FWD.orients, primerHits, fn = myfiles.For.cut[[1]]), 
      FWD.ReverseReads = sapply(FWD.orients,primerHits, fn = myfiles.Rev.cut[[1]]), 
      REV.ForwardReads = sapply(REV.orients, primerHits,fn = myfiles.For.cut[[1]]), 
      REV.ReverseReads = sapply(REV.orients, primerHits, fn = myfiles.Rev.cut[[1]]))

                 Forward Complement Reverse RevComp
FWD.ForwardReads       0          0       0       0
FWD.ReverseReads    1720       1715    1707    1518
REV.ForwardReads       0          0       0       0
REV.ReverseReads    1834       1826    1728    1744

So some primers are getting trimmed but it's not all 0's as is expected...

Also, I sometimes get the following warning (especially if I use the -g and -G flags instead of the linked adapters).

WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.

A final update which might complicate things. For some reason, the sequencing place used 4 ITS1 primers so while I have 4 potential ITS1 forward and reverse sequences, this still doesn't explain why I am able to trim all primers on forward reads with the primers I provided above. So it would seem to me, the forward reads were primed with the single primer set but somehow there are additional primers for reverse reads? This does not make sense to me but here are the additional sequences I could have for the forward and reverse ITS1 primers (all are TruSeq primers). I have just added stars around the primer sequences just to make it clearer (the astericks are not a part of the sequence):

Forward1 = ACACTCTTTCCCTACACGACGCTCTTCCGATCT**CTTGGTCATTTAGAGGAAGTAA**
Forward2 = ACACTCTTTCCCTACACGACGCTCTTCCGATCTT**CTTGGTCATTTAGAGGAAGTAA**
Forward3 = ACACTCTTTCCCTACACGACGCTCTTCCGATCTAC**CTTGGTCATTTAGAGGAAGTAA**
Forward4 = ACACTCTTTCCCTACACGACGCTCTTCCGATCTCAA**CTTGGTCATTTAGAGGAAGTAA**

Reverse1 = GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT**GCTGCGTTCTTCATCGATGC**
Reverse2 = GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT**GCTGCGTTCTTCATCGATGC**
Reverse3 = GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAC**GCTGCGTTCTTCATCGATGC**
Reverse4 = GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAT**GCTGCGTTCTTCATCGATGC**