This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove Illumina TruSeq Index adapters

Hi,

I'm analysing data from a multiplexed RNA-seq experiment where the library was generated using the Ilumina TruSeq Universal Adapter and the Illumina TruSeq Index Adapters (see page 12 of this letter from Illumina).

From the FastQC report I can see a slight adapter contamination and I'd like to remove all adapters from the FASTQ files before progressing with the analysis. I'm using Scythe, which needs the adpater sequences in FASTA format. This is my FASTA file:

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Universal_Adapter_RC
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>TruSeq_Index_Adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq_Index_Adapter_RC
CAAGCAGAAGACGGCATACGAGAT

My questions are:

  1. For the index adapter, I'm using the invariable part of the sequence at the 5'- end of the 6 bases-long barcode (TruSeq_Index_Adapter) and the reverse complement of the sequence at the 3'- end of the 6-bases-long barcode (TruSeq_Index_Adapter_RC). Is this correct?
  2. Do I need to include the adapters' reverse complements at all or this is already taken care of when specifying the forward sequence?

Thanks!

scythe sequencing next-gen fastqc rna-seq
• 12,942 views • link
updated by Ram Ram • written by enricoferrero enricoferrero

Hello Enrico!

It appears that your post has been cross-posted to another site: SEQanswers.

This is typically not recommended as it runs the risk of annoying people in both communities.

• 0 views • link
updated by Ram Ram • written by Devon Ryan Devon Ryan

Hi Devon,

Sorry, I had no idea this was an issue! Should I remove the SEQanswers one?

• 0 views • link
updated by Ram Ram • written by enricoferrero enricoferrero

I'm not sure that you can. Just keep that in mind in the future.

• 0 views • link
updated by Ram Ram • written by Devon Ryan Devon Ryan

I have same question as OP; Thus: What would be the post on SEQanswers?

• 0 views • link
written by unksci unksci

I am looking for answers to the same question but not able to find this question at SEQanswers. Can you direct me to the post?

• 0 views • link
written by mnazir • mnazir

3 answers

If I am correct there's something about Scythe and 5'- end, you may want to check out their readme.

This post explains the thumb rule of trimming adaptors https://www.biostars.org/p/83146/ worth a look.

• 0 views • link
updated by Ram Ram • written by ngsgene ngsgene

Check-out the Trimmomatic and ILLUMINACLIP function. It has a library for different TruSeq adapters which you specify in command.

• 0 views • link
written by boczniak767 boczniak767

simply use 123Fastq recommendations to trim.

• 0 views • link
written by milad eidi • milad eidi

Please stop advertising your tool on old threads. Instead, create a Tool type post as you did before with proper links this time.

• 0 views • link
written by Ram Ram

Log in to answer this question.

More posts like this