I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want to know which sequences to cleave. Illumina TruSeq adapters were used. I have tried following Tuft's explanation and make sense of Illumina's video, but I am left with several unresolved questions.
The TruSeq Universal adapter, seems to be what binds to the flow cell and is
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
The TruSeq Adapter Index N is
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG
My impression of how the cDNA fragment attached to the adapters is
Here are my questions :
- Is this image correct in the single stranded case?
- Do I have the correct primer binding site (used for the actual sequencing)?
- Do I have the correct oligo for paired end reads, i.e.
TAGAGCATACGGCAGAAGACGAAC---------? - Do I have the correct primer (and it's site) for the index read?
Per Illumina, I guess I need to include this : "Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited."
1 answer
Have you considered just using an available program to do this?
Cutadapt has worked quite well for me.
They also handle Illumina Tru-Seq adapters: http://cutadapt.readthedocs.org/en/latest/guide.html#illumina-truseq
Log in to answer this question.