This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Understanding Illumina Adapters

I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want to know which sequences to cleave. Illumina TruSeq adapters were used. I have tried following Tuft's explanation and make sense of Illumina's video, but I am left with several unresolved questions.

The TruSeq Universal adapter, seems to be what binds to the flow cell and is

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

The TruSeq Adapter Index N is

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

My impression of how the cDNA fragment attached to the adapters is

(see text diagram here)

Here are my questions :

  1. Is this image correct in the single stranded case?
  2. Do I have the correct primer binding site (used for the actual sequencing)?
  3. Do I have the correct oligo for paired end reads, i.e.TAGAGCATACGGCAGAAGACGAAC---------?
  4. Do I have the correct primer (and it's site) for the index read?

Per Illumina, I guess I need to include this : "Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited."

oligos adapters illumina
• 7,160 views • link
updated by Ram Ram • written by irritable_phd_syndrome • irritable_phd_syndrome

1 answer

Have you considered just using an available program to do this?

Cutadapt has worked quite well for me.

They also handle Illumina Tru-Seq adapters: http://cutadapt.readthedocs.org/en/latest/guide.html#illumina-truseq

• 0 views • link
updated by Ram Ram • written by jotan jotan

Log in to answer this question.

More posts like this