This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How do people attach adapter to small RNA

Hi, everyone

In the illumina adapter sequences file LINK, they show adapters in this format 5'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[barcode]ATCTCGTATGCCGTCTTCTGCTTG So my question is normally where does small RNA attach to? the very left side of the whole adapters? or at the left side of barcode 5'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC(this place?)[barcode]?

small-rna-seq

2 answers

The barcode (aka index) is internal to the adapter; the RNA is attached to the end of the adapter.

A small RNA is no different from the rest of your RNA!!

If you're using the Nextera kit for example, a transposase adds a complementary end to your DNA so it can be attached to the adapter, which is then trimmed after sequencing. The barcode is a unique identifier so that you can multiplex samples, with that identifier being used to separate the samples after you have pooled them to sequence. The 5' end is eventually added so it can bind to the flow cell. So the bit you're adding to your sample is like this:

flow cell | unique identifier | adapter to be trimmed | your DNA

A small RNA is no different from the rest of your RNA!!

Not true. The termini are different, and small RNA library prep exploits that difference by using specific RNA ligases to directly attach the adapters (which are then reverse-transcribed and amplified by PCR). In contrast, standard RNAs are first reverse-transcribed to cDNA before adapter ligation and amplification.

I was working under the assumption that the whole RNA sample is going to be sequenced, which normal library preps do allow for capture of sRNAs.

...normal library preps do allow for capture of sRNAs.

No, standard library preps include steps [e.g., poly(A)+ enrichment, size selection] that exclude small RNAs, and most "total" RNA protocols state that explicitly.

I think you need to recheck the docs. Illumina TruSeq stranded RNA kit -

Library capture of both coding RNA, as well as multiple forms of non-coding RNA that are poly-adenylate

I think you need to recheck your knowledge of small RNAs (miRNAs, piRNAs, siRNAs):

1) small RNAs are not synonymous with non-coding RNAs. 2) these small RNAs are not polyadenylated, so would not be captured by this kit. 3) these small RNAs would also be excluded by the AMPure XP cleanup used in this kit.

I understand that you're trying to contribute, which is commendable, but posting erroneous information is not helpful.

1) not synonymous no, but typically so. There is actually no specific definition to small RNAs, just generally accepted rules. It's rather a catch-all don't you think? I work with bacterial small non coding RNA, so I naturally draw from that experience when answering. 2) There is evidence in the literature of polyadenylated small RNA. 3) You don't have to use the AMPure beads, but they capture everything >100bp (which still captures quite a lot, in my experience). Personally, if you're going to be doing RNAseq to identify small RNAs active in a particular condition, I would be inclined to capture the mRNA too to ensure your condition is behaving as you'd expect, what's the point without context?

It's unclear whether you're being intentionally provocative or merely a proponent of sloppy thinking/writing, so I'll try one final time:

1) small RNAs ≠ non-coding RNAs; rRNAs and lincRNAs are examples of the latter but not the former. And the OP mentioned small RNAs in the context of Illumina libraries, where the term is not a catch-all but specific to the categories I indicated.

2) if you have evidence that the small RNAs (not precursors) I indicated are polyadenylated, please provide citations.

3) the small RNAs that I indicated are <100bp, so it's immaterial if AMPure beads "capture quite a lot."

But all this is besides the point, in terms of where a small RNA sits with the adapters, a small RNA is not different to other sequencing - it sits in the exact same place as any other thing you'll be sequencing. That was my original point.

Log in to answer this question.