I generally analyze paired-end illumina platform geretaed fastq having 6mer barcode. For ex,
@K00171:40:H3KJTBBXX:8:1101:20518:2020 2:N:0:CGATGT
GCTGCTTCAATCCTTTCCTCTACTGTCATGTCACTTCGGGCTTTCCCCTCTTTGACATCAATAAGTTCAACTTCATAAACAAGGTCTGCCATCAATCGTTA
+
A,A,F<KAFKFKFKFKKFKAFAFKAKKKFKKAFKKKKKKKKAAAAKKKKKKAKKFKKKKKKKFAKFA7FFFKKKKKFKFKFKFKFKKKKKKFFKKFKKKFK
For removing the adapters, I run the following trim_galore command,
trim_galore –paired –phred333 –q 20 –a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[6BASE]ATCTCGTATGCCGTCTTCTGCTTG – stringency 5 –e 0.1 –t –r1 35 –r2 35 pair_1.fq pair_2.fq
But now I got fastq files from sequencing company with 8mer+8mer barcode. For ex header is like ,
@K00171:711:HVYHKBBXX:4:1101:28036:1332 1:N:0:ACACAAAA+GGAGATCA
I couldn't find any documents regarding this system in the pdfs. Can anyone suggest my how the adapter trimming can be used in this case?
The sequencing protocol,
Library Kit : TruSeq RNA Sample Prep Kit v2
Library Protocol: TruSeq RNA Sample Preparation v2 Guide, Part # 15026495 Rev. F
•
written
by
rice.researcher
You can use the default sequence for TruSeq adapters: AGATCGGAAGAGC. This corresponds to the sequence you posted with the A overhang. You should have been using this from the beginning rather than putting in the entirety of the barcode sequence, which just created excess work for you. BTW, you don't even need to specify an adapter sequence, TrimGalore has this one built in.
Thanks @Devon for the suggestion.! BTW, I' not sure how the 8mer+8mer case come? If you could give a search keyword for this kind of barcoding, it would be helpful for me to further look into to available documents.
You have dual indices, that's pretty common.
Log in to answer this question.