Hello every one I have paired end illumina reads for chip-seq analysis. Fastqc report adapter content and all so per sequence GC content not passing, I tried trimmomatic but still i am getting same result. can anyone suggest me how can I resolve this problem
command I tried
trimmomatic PE read1.fastq.gz read2.fastq.gz filt_read1.fastq.gz read2.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 HEADCROP:20
after this still did not pass the adapter content and per sequence GC content
TruSeq3-PE.fa file contains collected from different biostar threads
>Illumina_Universal_Adapter (copied from FastQC data files)
AGATCGGAAGAG
>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Universal_Adapter_RC
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
>TruSeq_Index_Adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>TruSeq_Index_Adapter_RC
CAAGCAGAAGACGGCATACGAGAT
Can any one suggest me how can I resolve this Thank you
result image
https://drive.google.com/file/d/15SC0r31eJFDYs9Rowysxd4853iO1XQBW/view?usp=sharing, https://drive.google.com/file/d/1msoloMqHHBfCTuAyAqPXxJYyomZBeVdX/view?usp=sharing
Thank you
•
written
by
luckysardar171 •
0 answers
No answers yet.
Log in to answer this question.
Have you checked that the adapter sequence given by fastqc is the same sequence that is in TruSeq3-PE.fa ?
No I did not check can you suggest me how we can do.
Check this thread What is the right illumina universal adapter sequence for trimming paired-end reads?
Thank you, but already went through this thread still did'nt get the result
Try bbduk.sh. Tutorial also available.
Thank you, i am trying bbduk, Adapter trimming i have done but compare to trimmomatics its removing lot of reads(removing in millions(36149148 to 26801764)) is it not two much of removal
If you have bad data i.e. a lot of primer dimers/short inserts then there is not much you can do. Please post images according to the instructions below by editing your original post.
Please use: How to add images to a Biostars post instead of google drive links.
If you are aligning to a good reference you don't need to strictly remove the adapters. Aligner will soft clip them.
data is from chip-seq i am using bowtie2 aligner(recommended encode ) its a end to end aligner