Hello all,
I have paired end rna-seq reads and have tried to trim using trimmomatic. I am trying to better understand how it works. For the adapters file used for trimming, TruSeq3-PE.fa did not remove adapters from overrepresented sequences in FastQC but TruSeq3-PE-2.fa did which includes reverse complements of adapter sequences did. This file is shown below.
>PrefixPE/1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE/2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE1_rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>PE2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE2_rc
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Just for a quick look at raw reads using grep, it was mainly PE2_rc detected in the forward read and in the reverse read, it was mainly PE1_rc that was detected. But not PrefixPE/1 in forward read and PrefixPE/2 in reverse read.
Question: is this normal for PE2_rc to be found in read 1 and PE1_rc to be found in read 2? (I guess I was expecting PrefixPE/1 to be found in read 1 and PrefixPE/2 in read 2)
Thanks.
0 answers
No answers yet.
Log in to answer this question.