This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Does this mean it is running? It has been like this for a while. I am using Trimmomatic.
java -jar /path/to/trimmomatic-0.39.jar \
    PE -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz \
                SRR2589044_1.trim.fastq.gz SRR25> 89044_1un.trim.fastq.gz \
                SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz \
                SLIDINGWINDOW:4:20 M> INLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15> > 
TrimmomaticPE: Started with arguments:
 -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz SRR2589044_1.trim.fastq.gz SRR2589044_1un.trim.fastq.gz SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz SLIDINGWINDOW:4:20 MINLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15
Multiple cores found: Using 4 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
next-gen software rna-seq

You've been asked not to delete posts that have received feedback - don't keep doing that.

Hi, you deleted a post after being asked specifically not to delete it. Please stop abusing the forum or your account will be suspended.

my questions involve my path to my terminal which is a personal information. I won't post in this website ever again. Can you please delete them. That is my private information. @Ram

all my questions involve my terminal path

You can edit and change the paths - it is always a good idea to use fake paths. I'll make those changes now.

Look, some general forum etiquette:

This is an open forum where volunteers try to help out each other. That means, if you post a question and others invest time to answer, then it is good etiquette not to delete anything as this negates their efforts. Answers and comments can help people other than yourself, it's a knowledge repository. If you include private information then this is on you, as you could have easily edited them before submitting the question.

Please be respectful, invest some effort into your posts, format them properly and avoid cross-posts, or at least indicate them by putting a link to the other community. People here are happy to help, so lets stay cool and nice.

I won't post in this website ever again.

Just use it properly - you're welcome as long as you're using the forum right. If not, it sours the experience for everybody.

1 answer

Yes this means the command is running. It will take a while for things to finish when you have good size datasets. Alignments will take several hours. Unless you see an obvious error or the program exits you do not need to worry in general.

Log in to answer this question.