This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic job won't end

Hi,

I am trying to trim some reads Ive been given. I am trying to run it on several hundred paired end reads. These are kept in directories so that the directory "samples" contains each patient ID, which contains the forward and reverse fastq.gz files.

I am using a submit script, the arguments provided therefore are ${1} is the patient ID and ${2} is the code for the fastq.gz file.

The script I have is:

FASTQ_DIR="Path to samples"/samples/${1}
OUT_DIR="Path to out"/TRIM/${1}

mkdir -p ${OUT_DIR}

module add Java/1.8.0_144

java -jar /"Path to software"/software/Trimmomatic-0.39/trimmomatic-0.39.jar PE \
-phred33 \
${FASTQ_DIR}/${2}_R1_001.fastq.gz \
${FASTQ_DIR}/${2}_R2_001.fastq.gz \
-baseout ${OUT_DIR}/${2}.fastq.gz \
ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 \
LEADING:3 \
TRAILING:3 \
SLIDINGWINDOW:4:15 \
MINLEN:36

What happens then if I execute the script:

$ . TRIM.sh "PatientID" "SampleID"

Picked up _JAVA_OPTIONS: -Djava.io.tmpdir=/scratch
TrimmomaticPE: Started with arguments:
 -phred33 "Path to first fastq" "Path to second fastq" -baseout "Path to out" ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

It then stays here indefinitely and just won't do anything else until I cancel it. It created the output files but they aren't correct and appear corrupted.

Any advice would be greatly appreciated here, I'm not great at bioinformatics so any explanation would be welcomed. Obviously I took out the patientID etc..

Thanks

trimming software error rna-seq
• 2,386 views • link
updated by Biostar Biostar • written by James Clark • James Clark

Can you check with top if the job is running or not, so if it is simply a problem with exiting the process? Are you on a cluster with a scheduler?

• 0 views • link
written by ATpoint ATpoint

Hi, thanks for your response, Top shows the process running, it will run for an amount of time (usually a few minuets) then disappear and give a file that "ends unexpectedly" If I run it on my own screen it will never exit the job. Im on a cluster that uses Slurm workload manager. Thank you

• 0 views • link
written by James Clark • James Clark

Are FASTQ_DIR and OUT_DIR both available on the node where the job is being run?

• 0 views • link
written by GenoMax GenoMax

The script I have is

/Downloads/Trimmomatic-0.36$ java -jar trimmomatic-0.36.jar SE '/home/rasoul/Desktop/Data/ngs/SRR941816_fastqc.zip' /home/rasoul/Desktop/Data/ngs/SRR941816/keep.gz ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10‬‬ ‫‪TRAILING:20‬‬ ‫‪SLIDINGWINDOW:6:20‬‬ ‫‪MINLEN:35

What happens then if I execute the script:

TrimmomaticSE: Started with arguments:
 /home/rasoul/Desktop/Data/ngs/SRR941816_fastqc.zip /home/rasoul/Desktop/Data/ngs/SRR941816/keep.gz ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10‬‬ ‫‪TRAILING:20‬‬ ‫‪SLIDINGWINDOW:6:20‬‬ ‫‪MINLEN:35
Automatically using 4 threads
Exception in thread "main" java.lang.NumberFormatException: For input string: "10‬‬"
    at java.lang.NumberFormatException.forInputString(NumberFormatException.java:65)
    at java.lang.Integer.parseInt(Integer.java:580)
    at java.lang.Integer.parseInt(Integer.java:615)
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:56)
    at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:32)
    at org.usadellab.trimmomatic.Trimmomatic.createTrimmers(Trimmomatic.java:59)
    at org.usadellab.trimmomatic.TrimmomaticSE.run(TrimmomaticSE.java:303)
    at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:85)
• 0 views • link
updated by Ram Ram • written by rasoulfarzaneh • rasoulfarzaneh

How is this an answer to the top-level question? If this is not an answer, it should be either a comment or a new question.

• 0 views • link
written by Ram Ram

Hi The script I have is

tophat -p 4 --b2-very-sensitive -G '/home/rasoul/Desktop/Data/ngs/genome/annotation.gtf' /Home/rasoul/Desktop/Data/ngs/genome/genome '/Home/rasoul/Desktop/Data/ngs/SRR941816/keep16.gz' 


Error:
[2020-04-05 18:15:48] Beginning TopHat run (v2.1.1)
-----------------------------------------------
[2020-04-05 18:15:48] Checking for Bowtie
          Bowtie version:    2.2.5.0
[2020-04-05 18:15:48] Checking for Bowtie index files (genome)..
Error: Could not find Bowtie 2 index files (/Home/rasoul/Desktop/Data/ngs/genome/genome.*.bt2l)
• 0 views • link
updated by GenoMax GenoMax • written by rasoulfarzaneh • rasoulfarzaneh

Please don't post unrelated questions in existing threads.

• 0 views • link
written by GenoMax GenoMax

If you are trying to run a transcriptome only run with -G option then you are not supposed to provide reads for that run.

For example, in order to just prepare the transcriptome index files for a specific annotation, an initial, single TopHat run could be invoked like this:
tophat -G known_genes.gtf \
    --transcriptome-index=transcriptome_data/known \
    hg19

You should also consider switching to a newer aligner than TopHat.

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Trimmomatic 0.39 fails for adapters
    written by pinheirofabiano • pinheirofabiano
    I'm trying to trim my RNA-Seq FASTQ files, but it's not working.. The parameters I'm using are: java -jar ~/Applications/Trimmomatic-0.39/trimmomatic-0.39.jar SE -phred33 shock02_RNASeq.fastq.gz trimmed_shock02.fastq.gz LEADING:3 …
  • Trimmomatic .jar not included anymore?
    written by Emily • Emily
    I tried to run Trimmomatic 0.39 but ran into `Error: Invalid or corrupt jarfile /storage/home/user/tools/Trimmomatic-0.39/`. I went into the Trimmomatic directory and noticed that the …
  • Trimmomatic
    written by sehriban.buyukkilic • sehriban.buyukkilic
    Hi everyone, I have one problem with my code, but I couldn't understand what is it. Anyone can say what is wrong with me code, …
  • Trimmomatic adapter file not found when running using conda environment (Nextflow)
    written by Eliveri • Eliveri
    I have a nextflow script which uses trimmomatic, I am running the script using a conda environment from HPC server. Trimmomatic is able to run …
  • Does this mean it is running? It has been like this for a while. I am using Trimmomatic.
    written by sam • sam
    ``` java -jar /path/to/trimmomatic-0.39.jar \ PE -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz \ SRR2589044_1.trim.fastq.gz SRR25> 89044_1un.trim.fastq.gz \ SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz \ SLIDINGWINDOW:4:20 M> INLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15> > TrimmomaticPE: Started …
  • Exec format error
    written by sam • sam
    ``` java -jar /path/to/trimmomatic-0.39.jar /path/to/20191205.B-2744XJ_3_1.fastq.gz /path/to/20191205.B-2744XJ_3_2.fastq.gz 0191205.B-JX2744XJ_3_1.trimmed.R1.paired.fastq.gz 0191205.B-JX2744XJ_3_1.trimmed.R1.unpaired.fastq.gz 0191205.B-JX2744XJ_3_2.trimmed.R2.paired.fastq.gz 0191205.B-JX2744XJ_3_2.trimmed.R1.unpaired.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa.2:30:10 LEADING:3 TRAILING:3 MINLEN:36 -sh: 171: /path/to/20191205.B-2744XJ_3_1.fastq.gz: Exec format error ``` I've been trying this …
  • Trimmomatic parameters
    written by ronny • ronny
    $java -jar /apps/eb/Trimmomatic/0.39-Java-1.8.0_144/trimmomatic-0.39.jar PE -phred33 seq1_L2_1.fq.gz seq1_L2_2.fq.gz _L2_r1_paired_fq.gz seq1_L2_r1_unpaired.fq.gz seq_L2_r2_paired.fq.gz Seq1_L2_r2_unpaired.fq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:5 #what values I should use for following parameters? ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 …
  • Confusion about trimmomatic
    written by szahid • szahid
    Hi All, I'm new to bioinformatics and currently working on some rna seq data. I'm using trimmomatic to remove adaptor contamination. I'm using the following …
  • Trimmomatic execution removes the data from my fastq sequence file. What am I doing wrong?
    written by kristina.mahan kristina.mahan
    I'm trying to use Trimmomatic 0.38 to trim my Illumina fastq sequences. Something must be wrong with my syntax because after execution I get a …
  • trimmomatic for quality trimming
    written by blooming.daisy333 • blooming.daisy333
    I am using trimmomatic for quality trimming of Paired reads. however, i am unable to get equal numbrer of reads in paired read files. Can …