This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Confusion about trimmomatic

Hi All,

I'm new to bioinformatics and currently working on some rna seq data. I'm using trimmomatic to remove adaptor contamination.

I'm using the following script and I get the following message. It's been like this for an hour, how do I make sure its even working and not just stuck?

]$ java -jar /gscratch/stf/szahid/Trimmomatic-0.39/trimmomatic-0.39.jar PE -phred33 /gscratch/stf/szahid/VD03_R1_001.fastq.gz /gscratch/stf/szahid/VD03_R2_001.fastq.gz VD03_R1_001.paired.fastq.gz VD03_R1_001.unpaired.fastq.gz VD03_R2_001.paired.fastq.gz VD03_R2_001.unpaired.fastq.gz ILLUMINACLIP:/gscratch/stf/szahid/Trimmomatic-0.39/adapters/TruSeq3-PE.fa/:2:30:10 LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36 -trimlog VD03.log

TrimmomaticPE: Started with arguments:

 -phred33 /gscratch/stf/szahid/VD03_R1_001.fastq.gz /gscratch/stf/szahid/VD03_R2_001.fastq.gz VD03_R1_001.paired.fastq.gz VD03_R1_001.unpaired.fastq.gz VD03_R2_001.paired.fastq.gz VD03_R2_001.unpaired.fastq.gz ILLUMINACLIP:/gscratch/stf/szahid/Trimmomatic-0.39/adapters/TruSeq3-PE.fa/:2:30:10 LEADING:5 TRAILING:5 SLIDINGWINDOW:4:15 MINLEN:36 -trimlog VD03.log

Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'

ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

Any help would be appreciated thanks!

rna-seq

0 answers

No answers yet.

Log in to answer this question.