This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Exception in thread "main" java.lang.RuntimeException: Sequence and quality length don't match

Hello, I am trying to trimming some data but I have not been able to do it because the process is interrupted, could you help me?

(base) user:~/Enrique_Manuel/aspergillus/trimeados$ java -jar /home/betterlab/Enrique_Manuel/programas/Trimmomatic-0.39/trimmomatic-0.39.jar PE ../DRR178650_1.fastq  ../DRR178650_2.fastq DRR178650_P_1.fastq DRR178650_U_1.fastq DRR178650_P_2.fastq DRR178650_U_2.fastq ILLUMINACLIP:/home/betterlab/Enrique_Manuel/programas/Trimmomatic-0.39/adapters/TruSeq3-PE.fa:2:30:10 SLIDINGWINDOW:4:15 MINLEN:36

TrimmomaticPE: Started with arguments: ../DRR178650_1.fastq ../DRR178650_2.fastq DRR178650_P_1.fastq DRR178650_U_1.fastq DRR178650_P_2.fastq DRR178650_U_2.fastq ILLUMINACLIP:/home/betterlab/Enrique_Manuel/programas/Trimmomatic-0.39/adapters/TruSeq3-PE.fa:2:30:10 SLIDINGWINDOW:4:15 MINLEN:36 Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT' ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33

Exception in thread "main" java.lang.RuntimeException: Sequence and quality length don't match: 'TCGGAGTGAACACGAACACTCTGTAGGAGATGACGAAAGCGTGCAGAACAATGACTTTTCGAACGTCCTTCAAGGTATGACTGGTAATGTCGATGTCCAGG' vs 'BBBBBGGGFGGGGGGGFGGGGGGGGGGGGGGGFGGGGGFGGGGGGGGGGGEGFEGGGGGGGGGEGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGD*@DRR178650.18192050 18192050 length=101' at org.usadellab.trimmomatic.fastq.FastqRecord.<init>(FastqRecord.java:25) at org.usadellab.trimmomatic.fastq.FastqParser.parseOne(FastqParser.java:89) at org.usadellab.trimmomatic.fastq.FastqParser.next(FastqParser.java:179) at org.usadellab.trimmomatic.TrimmomaticPE.processSingleThreaded(TrimmomaticPE.java:63) at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:316) at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:555) at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:80)

trimmomatic
• 1,795 views • link
written by san96 • san96

The same with fastp:

(base) user:~/Enrique_Manuel/aspergillus/trimeados$ fastp -i ../DRR178650_1.fastq -I ../DRR178650_2.fastq -o DRR178650_P_1.fastq -O DRR178650_P_2.fastq --detect_adapter_for_pe

Detecting adapter sequence for read1...

Illumina TruSeq Adapter Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Detecting adapter sequence for read2...

Illumina TruSeq Adapter Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

ERROR: sequence and quality have different length: @DRR178650.18192049 18192049 length=101 TCGGAGTGAACACGAACACTCTGTAGGAGATGACGAAAGCGTGCAGAACAATGACTTTTCGAACGTCCTTCAAGGTATGACTGGTAATGTCGATGTCCAGG +DRR178650.18192049 18192049 length=101 BBBBBGGGFGGGGGGGFGGGGGGGGGGGGGGGFGGGGGFGGGGGGGGGGGEGFEGGGGGGGGGEGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGD*@DRR178650.18192050 18192050 length=101

• 0 views • link
written by san96 • san96

1 answer

Your fastq file is corrupt, as you can see from the error message. You need to redownload it and/or try again to make sratoolkit process it correctly. Possibly, posting the commands you are using to create the fastq from the sra might help.

• 0 views • link
written by Brian Bushnell Brian Bushnell

Beyond that, do yourself a favor and keep fastq files gzipped. No application ever needs raw text files, they take up space.

• 0 views • link
written by ATpoint ATpoint

Thanks for the observation and I am actually working with the compressed files but I am getting the same problem, that's why I tried fastq.

• 0 views • link
written by san96 • san96

Log in to answer this question.

More posts like this
  • Trimmomatic command
    written by rajdeepboral00 • rajdeepboral00
    The command i am using for trimming my adaptors from the sample data is java -jar /data/sata_data/home/Rajdeep/Rajdeep/Trimmomatic-0.39/trimmomatic-0.39.jar PE -phred33 CC1_R1.fastq.gz CC1_R2.gz CC1_R1_paired.fastq.gz CC1_R1_unpaired.fastq.gz CC1_R2_paired.fastq.gz CC1_R2_unpaired.fastq.gz …
  • Error in trimmomatic
    written by Anderson Stiward • Anderson Stiward
    Hi! Trust you are well. I am trying to run this program but I get the following error and I dont know to fix it …
  • When I run Trimmomatic, I continue to get an "unknown trimmer" error and cannot figure out how to f…
    written by littlemicrobiologist • littlemicrobiologist
    I have applied following in the folder where the data is: java -jar Trimmomatic-0.39/trimmomatic-0.39.jar PE phred33 /home/*/*R1.fastq.gz /home/*/*R2.fastq.gz *R1.trimmed.fastq.gz *R1.untrimmed.fastq.gz *R2.trimmed.fastq.gz *R2.untrimmed.fastq.gz ILLUMINACLIP:/home/Trimmomatic/adapters/TruSeq3-SE.fa:2:30:7 MINLEN:15 the …
  • Trimmomatic problem
    written by sehriban.buyukkilic • sehriban.buyukkilic
    hi everyone, Is anyone can help me with trimmomatic problem?* I'm trying to run it but it's giving error like that: -bash-4.2$ java -jar /truba/home/sbuyukkilic/trimmomatic/Trimmomatic-0.39/trimmomatic-0.39.jar …
  • Confusion about trimmomatic
    written by szahid • szahid
    Hi All, I'm new to bioinformatics and currently working on some rna seq data. I'm using trimmomatic to remove adaptor contamination. I'm using the following …
  • error en trimmomatic
    written by laurapeaz_21315 • laurapeaz_21315
    Hola soy nueva usando trimmomatic y linnux use la siguiente linea de comando : lau@DESKTOP-1B4G2I6:/mnt/c/Users/acer/Documents/doctorado/Genoma 4IGSN1/4IgSN1$ java -jar /usr/share/java/trimmomatic.jar PE -threads 8 -phred33 1_HIg5N1_S1_L001_R1_001.fastq 2_HIg5N1_S1_L001_R2_001.fastq …
  • Trimmomatic jar file
    written by akashgari19 • akashgari19
    Hi everyone, I am using supercomputer to analyze my RNA seq data and now I am in the step of adapter removal. I am trying …
  • Unknown trimmer, single end, i tried other solutions but not soved.
    written by Adriel Rosa • Adriel Rosa
    Good afternoon, I"d like to know how to solve some software error in trimmomatic, "Unknown trimmer", i'd tried other solutions that i found in the …
  • trimmomatic: command not found
    written by SeaStar • SeaStar
    hello, I'm new here. I was using trimmomatic and I put this commands, trimmomatic PE -phred33 testadapt.1.fastq testadapt.2.fastq test_trim_paired.1.fq.gz testes_trim_unpaired.1.fq.gz test_trim_paired.2.fq.gz test_trim_unpaired.2.fq.gz ILLUMINACLIP:/home/lab/Software/Trimmomatic-0.38/adapters/NexteraPE-PE.fa:2:30:10:4 LEADING:3 TRAILING:3 …
  • error in execution of Trimmomatic 0.36
    written by F.I.2011 • F.I.2011
    I am new in Linux and Trimmomatic , do after installation i need to run it by any specific command **I am using this command:** …