This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Interpretation of Results from trimmomatic

Hi everyone,

I just got my results after I ran trimmomatic command. I had 50bp paired end reads for which I ran the following command 

**java -jar /opt/asn/apps/trimmomatic_0.35//Trimmomatic-0.35/trimmomatic-0.35.jar PE -phred33 SL264821_1.fastq.gz SL264821_2.fastq.gz SL264821_1_paired.fastq.gz SL264821_1_unpaired.fastq.gz SL264821_2_paired.fastq.gz SL264821_2_unpaired.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10  LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36**

I got the results like this: 

Multiple cores found: Using 2 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 25549917
Both Surviving: 23523510 (92.07%)
Forward Only Surviving: 1134600 (4.44%)
Reverse Only Surviving: 409189 (1.60%)
Dropped: 482618 (1.89%)

I am quite confused on the command SLIDINGWINDOW ans MINLEN that I used and the result I don't know how to interpret this. Am I on the right track? Are my trimmed results ok for next steps. And after this do I have to do fastqc for all the four output files? I am so confused with all of these since I am entirely new to Bioinformatics and it quite overwhleming for me. Any suggestions might help.

Thank you, Ambika Pokhrel

rna-seq trimmomatic result
• 5,947 views • link
updated by finswimmer finswimmer • written by AP • AP

First of all, what is your data - mRNA, miRNA, ChIP-seq? Library preparation? Intended insert size?

Anyway, your results seems fine, but it would help to have more details about your data.

• 0 views • link
written by h.mon h.mon

Sorry i forgot to mention, my data is mRNA from Fusarium oxysporum

• 0 views • link
written by AP • AP

1 answer

Hello,

have you read the manual and know what you are doing, or have you just did copy&paste from somewhere?

What you command is doing is:

  1. Remove adapter sequences (ILLUMINACLIP)
  2. Remove all bases with a basequality lower than 3 beginning from the 5' end (LEADING)
  3. Remove all bases with a basequality lower than 3 beginning from the 3' end (TRAILING)
  4. If the average quality of 4 bases side-by-side falls below 15 trimm the read (SLIDINGWINDOW)
  5. DIscards reads that have less the 36 bases (MINLEN)

So, as you have paired end reads it is necessary to give both fastq file as input. As your trimming can result in discarding whole reads, it is necessary to distinguish the outpout where both reads of the pair survive and those where just one of the two reads survive.

You have to decide by your own whether you take all output files for further downstream analyses. It depends on what you are doing. I personally would just take the paired reads.

fin swimmer

• 0 views • link
written by finswimmer finswimmer

Yes I read the manual before and set my commands I was however doubting on the option MINLEN since my reads were of 50bp. Well now since the data looks good I think I will move ahead with Fastqc again and further process.

Thank you for the information.

• 0 views • link
written by AP • AP

Log in to answer this question.

More posts like this