Hi everyone,
I just got my results after I ran trimmomatic command. I had 50bp paired end reads for which I ran the following command
**java -jar /opt/asn/apps/trimmomatic_0.35//Trimmomatic-0.35/trimmomatic-0.35.jar PE -phred33 SL264821_1.fastq.gz SL264821_2.fastq.gz SL264821_1_paired.fastq.gz SL264821_1_unpaired.fastq.gz SL264821_2_paired.fastq.gz SL264821_2_unpaired.fastq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36**
I got the results like this:
Multiple cores found: Using 2 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 25549917
Both Surviving: 23523510 (92.07%)
Forward Only Surviving: 1134600 (4.44%)
Reverse Only Surviving: 409189 (1.60%)
Dropped: 482618 (1.89%)
I am quite confused on the command SLIDINGWINDOW ans MINLEN that I used and the result I don't know how to interpret this. Am I on the right track? Are my trimmed results ok for next steps. And after this do I have to do fastqc for all the four output files? I am so confused with all of these since I am entirely new to Bioinformatics and it quite overwhleming for me. Any suggestions might help.
Thank you,
Ambika Pokhrel
rna-seq
trimmomatic
result
First of all, what is your data - mRNA, miRNA, ChIP-seq? Library preparation? Intended insert size?
Anyway, your results seems fine, but it would help to have more details about your data.
Sorry i forgot to mention, my data is mRNA from Fusarium oxysporum