This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Cutadapt paired end reads with 1 adapter list fasta

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

cutadapt --quiet -q 10,10 -aA /Volumes/My\ Passport/Documents/adapters.fa -o out_1.fastq -p out_2.fastq in_1.fastq in_2.fastq

I purposefully left out -O command (min overlap length, of 25) because the overrepresented Kmers in my FastQC report showed 6 bp sequences commonly found in TruSeq adapters. The default min overlap is 3 bp.

Also, in an example pipeline, I found these (highlighted) commands that I could not understand why it was necessary.

ls *R1_001.fastq | parallel -j $PARALLEL_TASKS "cutadapt -q 10,10 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -O 25 {} 2> {.}.cutadapt | sed 's/^$/C/g' > {.}_adapt.fastq​
                                                                                                             ^^^                      ^^^^^^^^^^
rna-seq illumina cutadapt

1 answer

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

I remember checking this and the answer is yes, you can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

Thank you for your reply, dariober. For projects dealing with 100+ samples, is it still common practice to manually verify the quality of pre-,post-alignment QC reports?

EDIT: Should I only use the -a (for forward adapter) and leave -A (for reverse adapter) out if cutadapt automatically flips the adapter sequence for the paired file?

Log in to answer this question.