The guide fails to mention the resources directory is on github which from experience, took a bit of extra digging around than was necessary.
It's here: https://github.com/BioInfoTools/BBMap/blob/master/resources/adapters.fa
Hi All, I have some Sureselect XT2 and Novaseq data, I used Agilent AGenT trimmer as suggested by Agilent but FASTQC showed that there are Illumina universal adapter sequences remaining. Does anyone work with this tool before?
So then I used the TruSeq R1 and R2 adapter sequences in the Illumina adapter document to trim:
>Read1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
>Read2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
After trimming with these two sequences, the FASTQC adapter curve flattened. But I also found part of the i5 adapter sequence. Do I need to trim this as well? how do I know what other adapter sequences needed to be trimmed e.g. i5, i7 and universal Truseq adapters .. How do I know I have trimmed all the adapters that needed to be trimmed? It would be great if someone could show me an example of what adapter sequences do they put in the fasta file in Trimmomatic.
part of i5 adapter sequence
CGACGCTCTTCCGATCT
and what is the TruSeq3-PE.fa in Trimmomatic suitable for? because it only contains the PCR index and universal TruSeq adapter sequences which I have tried trimming with but the FASTQC adapter curve stay the same.
I use bbduk.sh from BBMap suite for my trimming needs. It comes with a universal file of adapter sequences in the resources directory. You could simply use the file with trimmomatic (or use bbduk itself). A guide is available here.
The guide fails to mention the resources directory is on github which from experience, took a bit of extra digging around than was necessary.
It's here: https://github.com/BioInfoTools/BBMap/blob/master/resources/adapters.fa
This is NOT the official BBTools repository. Official BBMap distribution is located at SourceForge.
Once you download and extract BBMap (from official repo), resources directory will be inside the uncompressed BBMap folder.
Log in to answer this question.