Does anyone know how to trim adapters from NuGen WG methylation and hydroxymethylated libraries? I was trying to use Trim Galore in Galaxy but didn't know the correct parameters.

The parameters the user is supposed to input are: 1. Adapter sequence to be trimmed (choices are, for example, automatic detection, Illumina Universal, user-defined adapter sequence)

1. Trims 1 bp off every read from its 3' end (yes or no)

2. Remove N bp from the 3' end of read 1

3. Remove N bp from the 3' end of read 2

4. Screen quality-trimmed sequences for 'CAA' or 'CGA' at the start of the read and, if found, removes the first two basepairs? yes or no I know this was an entry in the file I uploaded onto Miseq (Excel Comma Separated Values file: Adapter AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
   AdapterRead2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Thanks