How to create correct adapters for trimming (with trimmomtaic)

Dear community,

I am using Trimmomatic (Trimmomatic-0.36) to trimm Illumina reads from a transcriptome data set.

When I ask the company to provide me with the adapters needed for trimming, I get the following list:

Read1:

AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
AGATCGGAAGAGCACACGTCTGAAC
TGGAATTCTCGGGTGCCAAGG
AGATCGGAAGAGCACACGTCT
CTGTCTCTTATACACATCT
AGATGTGTATAAGAGACAG

Read2:

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
AGATCGGAAGAGCGTCGTGTAGGGA
TGGAATTCTCGGGTGCCAAGG
AGATCGGAAGAGCACACGTCT
CTGTCTCTTATACACATCT
AGATGTGTATAAGAGACAG

These reads I could now in general use and write them to an adapters list that I feed into trimmomatic.

But, how do I know if I have to also give the reverse complements?

I would be very greatful for your help and some insight!

thank you!

sequencing trimmomatic rna adapters trimming

• 926 views • link

updated 4.4 years ago by lieven.sterck

• written 4.4 years ago by Easybella •

what does the documentation of trimmomatic says about this? ;)

• 0 views • link

written 4.4 years ago by lieven.sterck

0 answers

No answers yet.

More posts like this

Trimmomatic - can`t find a path for to file
written 4.3 years ago by vvs.hazia •

I simply need to run Trimmomatic, but he doesn`t see input files. May be you know how to deal with it? #creating variables INPUT_DIR="path/folderinput" OUTPUT_DIR="path/folderoutput" …
Trimmomatic failing to cut known adapter
written 4.7 years ago by maxrwjones •

Hi all, Usually get on well with Trimmomatic but am having issues removing adapters from some paired-end RNA-seq data. Here's my process so far: 1) …
Trimmomatic options for Novaseq WES and samqualfilter? or filter by qualty in sam files
written 4.8 years ago by Edmond •

Hello , I am having headaches regarding this sample. I am performing WES for calling SNP and CNV. All was good until I wanted to …
Which adapters to use for trimming?
written 5.6 years ago by whb •

Hi All, I have some Sureselect XT2 and Novaseq data, I used Agilent AGenT trimmer as suggested by Agilent but FASTQC showed that there are …
What sequences should I use for ATAC-Seq adapter trimming using trimmomatic 0.36?
written 7.4 years ago by Gary

Hi, I want to use Trimmomatic 0.36 to trim ATAC-Seq adapter sequences. However, I am not sure which sequences I should use to trim our …
Interpretation of Trimmomatic Results after Paired-End Adapter Trimming
written 8.1 years ago by sevenless •

Hi, I have some questions concerning the output of Trimmomatic after adapter removal. I have 80 bp paired-end reads in Ilumina 1.9 encoding (Phred+33). Using …
Trimmomatic only for removing adapters
written 8.1 years ago by grant.hovhannisyan

Hi Biostars, I need to cut only adapters from my data using trimmomatic. I used the following command: java -jar /home/ghovhannisyan/Softs/Trimmomatic-0.36/trimmomatic-0.36.jar PE -threads 11 read1.fastq …
Trimmomatic not displaying summary
written 8.7 years ago by kiddodoraemon •

Hello all, i am a beginner in this field. i'm grateful for your advice and help : i was running Trimmomatic0.36 on terminal using my …
Do I need to download any specific adapters for Illumina small RNA sequencing kit?
written 9.4 years ago by bioinforesearchquestions

Hi Friends, Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The …
Trimmomatic not removing all Nextera adapters or N base calls
written 10.3 years ago by James Ashmore

I have single-end sequencing data prepared using the Illumina Nextera library prep kit. In my FastQC plots I can see [adapter contamination at the 3' …