This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Do I need to download any specific adapters for Illumina small RNA sequencing kit?

Hi Friends,

Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers.

I am currently using Trimmomatic tool for trimming process. Along with the tool, I have a list of adapters in FASTA format. Within Trimmomatic tool, there is a folder named "Adapters". It has following files

  • Illumina_Adapter_Full.txt
  • IlluminaAdapter-PE.fa
  • Illumina-MultiplexingPrimer.fa
  • Illumina-SmallRNAAdapter.fa
  • Illumina-TruSeqAdapter.fa
  • NexteraPE-PE.fa
  • TruSeq2-PE.fa
  • TruSeq2-SE.fa
  • TruSeq3-PE-2.fa
  • TruSeq3-PE.fa
  • TruSeq3-SE.fa

In my case, I used "Illumina-SmallRNAAdapter.fa" and "Illumina-MultiplexingPrimer.fa" for trimming the reads.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Do I need download any specific adapters for Illumina small RNA sequencing kit?

adapter trimming small rna trimmomatic cutadapt
• 4,055 views • link
updated by GenoMax GenoMax • written by bioinforesearchquestions bioinforesearchquestions

Illumina_Adapter_Full.txt IlluminaAdapter-PE.fa Illumina-MultiplexingPrimer.fa Illumina-SmallRNAAdapter.fa Illumina-TruSeqAdapter.fa

can any one provide these files link?

• 0 views • link
written by CHINMAYA • CHINMAYA

Files currently include with trimmomatic should cover all necessary Illumina adapters.

With small RNA kits there may be a kit specific adapter sequence so you should always check which kit was used and follow data processing instructions (if provided).

• 0 views • link
written by GenoMax GenoMax

1 answer

Just use fastqc to see if you even have any adapters that need trimming, and if you do, it will tell you what sequences you need to remove.

• 0 views • link
written by swbarnes2 swbarnes2

Log in to answer this question.

More posts like this