This is a test version of Biostars. For the public version, visit https://www.biostars.org.
RNA-seq Hiseq 2000 Trimming

Hi everybody,

I am working with some Illumina sequences and I have some doubts. Could someone help me, please? This sequences are from Hi-Seq 2000 but it was run in 2010.

I am not sure if it is single or paired end. How can I check that?

I am trimming it using trimmomatic 

trimmomatic SE -threads 10 -phred64 \
../../rawdata/BRS_I24.fastq \
BRS_I24_trim.fastq \
ILLUMINACLIP:/data/apps/trimmomatic/0.36/adapters/TruSeq2-SE.fa:2:30:10 \
LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

-However, in that time. Illumina had changed the type of quality score and then later the got back to the old one, I don´t know which one should I use. If is it the -phred64 or -phred33? The quality score looks like this: 

@HWI-ST365_0091:2:1:1192:1999#TGTCAT/1
CCTGCTCTAAATGCTTCTATTTGCCGCATGATTCCAGTCTTGACAGTTGCATCTGCCACCAAGGATATATACTCCTCCAAATTGTTGATATCAACAATT
+HWI-ST365_0091:2:1:1192:1999#TGTCAT/1
YXYY[[X[[cccccccccccccccccccc_____c__ccccc_c[cccZccccccZccccc\_c[\]]Z]YYYY[ZXXRYYY]V[[[[XSUSUUXXXRZ

-Also I was seeing that when the sequencing is from GA II it is better to use TruSeq2-SE.fa:2:30:10, while with Hiseq it is better use TruSeq3-SE.fa:2:30:10. Is that right? I know the the sequencing kit used was TruSeq(TM) SBS v5.

Thanks in advance

rna-seq
• 2,879 views • link
updated by GenoMax GenoMax • written by valopes • valopes

1 answer

I am not sure if it is single or paired end

If you only have one file then most likely the data is single-end.

That said, there is some chance that the file contains interleaved reads. If you take a look at the read that follows the example you posted and if it has a /2 at the end of the fastq headers (instead of /1 like in your example) then you would have paired-end data interleaved in a single file.

• 0 views • link
written by GenoMax GenoMax

Thank you, genomax!

Do you also have any idea about my other questions?

• 0 views • link
written by valopes • valopes

The example you posted seems be to in sanger fastq format. I generally use bbduk.sh from BBMap suite for trimming. That software contains an adapters.fa file in the resources directory in software bundle that covers all commonly used adapter sequences where you do not need to know the specifics of which version of adapters were used.

• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this