Single end read adapter trimming via flexbar
Hi guys I am beginner in sequence analysis.I am trying to trimming adapter because ı have seen that my data has adapters end of sequences according to multiqc result. Its is single end reads and ı have tried this commend in below for each fastq file
flexbar --adapters $RNA_REFS_DIR/illumina_multiplex.fa --zip-output GZ --reads $RNA_DATA_DIR/SRR309134.fastq --target $RNA_DATA_TRIM_DIR/SRR309134
and ı create file for adapter
>Multiplexing_Read_1_Sequencing_Primer_3_to_5
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>Multiplexing_Read_2_Sequencing_Primer_3_to_5
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>Single_end_Reads_Sequencing_Primer_3_to_5
CTGTCTCTTATACACATCT
But it doesnt trim anything in sequences. and multiqc still shows adapter in same place and same lenght. Anyone has any idea how ı can trim it precisely??
• 1,523 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Online help shows the following command line:
Perhaps you need the options at the end for the program to work. Take a look at the manual/in-line help.
thank you. But I am guessing that the problem is the fact that ı couldnt choose the right adapter.