This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Dual indexing i5/i7 with ATAC-seq

Hello,

I am constructing an ATAC-seq library using the standard Illumina kit (Nextera DNA Flex Library Prep, FC-121-1030). A previous user suggested dual indexing to minimise index hopping which I am grateful for. We have access to a Hiseq X-Ten (paired-end 100bp) and illumina suggests to use the reverse complement of the Index (i5) adapter sequence:

[url]https://emea.support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-14.pdf[/url]

I'm wondering if they mean that I need to include the reverse complement of the unique adapter into the primer that I will use to amplify my tagmented DNA, or whether this is specified at the sequencer to accommodate for differences between in how reads are generated?

For example, a standard i5 adapter = AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

What should I order to amplify my transposed libraries? The H502 i5 index: unique i5 bases in adapter = CTCTCTAT, does that mean I would order a primer with the reverse complement (ATAGAGAG) for the unique portion of an i5 standard index? = AATGATACGGCGACCACCGAGATCTACAC [ATAGAGAG] TCGTCGGCAGCGTC instead of AATGATACGGCGACCACCGAGATCTACAC [CTCTCTAT] TCGTCGGCAGCGTC as was used in this protocol presumably because they used a different sequencer: [url]https://www.encodeproject.org/documents/4a2fc974-f021-4f85-ba7a-bd401fe682d1/@@download/attachment/RenLab_ATACseq_protocol_20170130.pdf[/url]

From the original ATAC-seq protocol, they add the following bases to the 3' end of a standard i5 adapter that doesn't contain a unique index sequence. I'd imagine this is to mitigate loss of the 8 base unique index for PCR, but they've also added a few bases (AGATGT) to the 3' end of the i7 adapters that do contain a unique index sequence. Should I include this (AGATGTG) to my i5 primer order and can I use these with the i7 adapters as given in the in the Buenrostro 2013 protocol which include the extra 3' bases (AGATGT)?

Best, Eric

atac-seq dual indexing hiseq x-ten i7 i5

You could do what @ATpoint said below or order a kit.

Edit: Took out example link since it was not appropriate.

This kit is for TruSeq, but ATAC-seq is based on the Nextera adapter, so this will not work.

Brilliant! Thanks to you both for your replies and information. The excel spreadsheet is a game changer.

Best, Eric

You can accept @ATPoint's answer (green check mark) to provide closure to the thread.

Sure thing. I also edited my post and included a paper which lists these primers from the lab that developed ATAC-seq in case you want to double-check with an "official" resource.

1 answer

Use the primers listed in the supplement of this paper: https://www.nature.com/articles/s41467-018-05887-x#additional-information

They're adequate for ATAC-seq and work.

Hello, I realise this is a quite old post but was wondering if I could ask for some help!

I have recently prepared ATAC seq libraries (bulk ATAC seq) using the standard protocol and the primers from this publication/your helpful Excel table. The libraries looked absolutely fine on QC - nice nucleosomal bands on tapestation plots, and didn't require much additional amplification following the interim qPCR.

These were sequenced by my university's in-house sequencing core on a NextSeq 2000, using a NextSeq P3 kit, which to my understanding uses the standard Nextera sequencing primers, so should have worked fine with this approach. However, the facility have now told me that the run has failed because Read 1 (I think the i7 index) had very low intensity and they think that Read 1 therefore didn't prime. Do you have any idea why or how this could happen if I used these primers in this setup?

Any help or advice much appreciated

Read 1 and Index 1 are not the same. They are read independently. If read 1 did not work then it is possible that the libraries may not have proper ends. You can try qPCR with i7/i5 to make sure you get a product.

These are published primers, we and others used them extensively. Whatever is happening in your run is not a primer issue but I am afraid with the given information it is hard to help. You can try to run a quantification qPCR, e.g. KAPA or NEB NGS quantification kits which target the ends of the Illumina adapters. That will tell you whether the ends are correct, but again, these primers are excessively used, they work if done properly. Hope you can find out what happened. Did they include any internal controls to the sequencing to tell whether it was a library or machine issue? It's been years that I operated a sequencer myself but isn't some sort of control always part of any Illumina run? I'd talk to them and see what they can do or contact Illumina support. Usually if there is the slightest chance it was a machine or reagent error they will refund you.

Log in to answer this question.