This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimming smRNA seq adaptors

Hello all! I am a newbie at RNA sequencing, and have a few questions on trimming:

1) The sequencing was done with the SMARTer small RNA Seq Kit. I found a user protocol that says I should only trim poly A tails, and the adapters are downstream from there, so they will be trimmed automatically. (see here - https://www.takarabio.com/documents/User%20Manual/SMARTer%20smRNA/SMARTer%20smRNA-Seq%20Kit%20for%20Illumina%20User%20Manual.pdf?srsltid=AfmBOop4wf0FrmrMccb2hevMuvf6akWxehMSX_8AzVFCOJgKambM1Mu_)

However when I do that, the FASTQC still founds high levels of illumina adapters.

Does anyone know this kit? Should I trim for poly A tails only? Or for the adapters as well?

2) I asked the sequencing company for the adapter sequence, and they answered:

(i7) Adapters

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG

(i5) Adapters

AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

How do I trim these adapters if necessary? What do I replace the [] with?

3) I saw on a similar post that for small RNA sequencing I should only look at the read 1's, and not the read 2's, as it will just duplicate my results. Most of the left adapters are indeed in the reverse reads. Is it true that I need to discarded them?

Thank you a lot!

trimming smallrna smaterkit

FASTQC still founds high levels of illumina adapters.

Was this data sequenced longer than recommended by the kit. It so you may see Illumina adapters. You can trim them using standard programs like bbduk.sh/fastp. Then follow the recommended protocol for data analysis (starting with trimming poly-A onwards) from Takara.

If Takara kit recommends single-end sequencing then you can ignore R2 data.

0 answers

No answers yet.

Log in to answer this question.